Construct: ORF TRCN0000468716
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004615.1_s317c1
- Derived from:
- ccsbBroadEn_11131
- DNA Barcode:
- TCCTCATGACACGCCACCTTTGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXW4 (6468)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468716
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6468 | FBXW4 | F-box and WD repeat domain ... | NM_001323541.1 | 89.7% | 89.5% | 1_99del;827T>C |
| 2 | human | 6468 | FBXW4 | F-box and WD repeat domain ... | XM_005270053.3 | 66.8% | 66.7% | 1_360del;768_839del;1160T>C |
| 3 | human | 6468 | FBXW4 | F-box and WD repeat domain ... | NM_022039.4 | 51.4% | 51.3% | 1_825del;1553T>C |
| 4 | human | 6468 | FBXW4 | F-box and WD repeat domain ... | XM_017016570.2 | 37.1% | 35% | (many diffs) |
| 5 | human | 26226 | FBXW4P1 | F-box and WD repeat domain ... | NR_033408.1 | 36.4% | (many diffs) | |
| 6 | human | 6468 | FBXW4 | F-box and WD repeat domain ... | NR_136613.2 | 32.5% | (many diffs) | |
| 7 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XM_011247261.2 | 80.5% | 84.9% | (many diffs) |
| 8 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | NM_013907.2 | 63.8% | 67.3% | (many diffs) |
| 9 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XM_006527131.3 | 39.9% | 42.1% | (many diffs) |
| 10 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XM_011247258.2 | 38.9% | 36.8% | (many diffs) |
| 11 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XR_001782592.1 | 34.7% | (many diffs) | |
| 12 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XR_877675.2 | 32.9% | (many diffs) | |
| 13 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XR_386481.3 | 30.3% | (many diffs) | |
| 14 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XR_386482.3 | 28.2% | (many diffs) | |
| 15 | mouse | 30838 | Fbxw4 | F-box and WD-40 domain prot... | XM_011247259.2 | 25.7% | 24.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc ctggatgcag ctagaggatg attctctgta catatcccag gctaatttca 121 tcctggccta ccagttccgt ccagatggtg ccagcttgaa tcgtcggcct ctgggagtct 181 ttgctgggca tgatgaggac gtttgccact ttgtgctggc caactcgcat attgttagtg 241 caggagggga tgggaagatt ggcattcata agattcacag caccttcact gtcaagtact 301 cggctcatga acaggaggtg aactgtgtgg attgcaaagg gggcatcatt gtgagtggct 361 ccagggacag gacggccaag gtgtggcctt tggcctcagg ccggctgggg cagtgcttac 421 acaccatcca gactgaagac cgagtctggt ccattgctat cagcccatta ctcagctctt 481 ttgtgacagg gacggcttgt tgcgggcact tctcacccct gagaatctgg gacctcaaca 541 gtgggcagct gatgacacac ttgggcagtg actttccccc aggggctggg gtgctggatg 601 tcatGTATGA GTCCCCTTTC ACACTGCTGT CCTGTGGCTA TGACACCTAT GTTCGCTACT 661 GGGACCTCCG CACCAGCGTC CGGAAATGTG TCATGGAGTG GGAGGAGCCC CACGACAGCA 721 CCCTGTACTG CCTGCAGACA GATGGCAACC ACCTGCTGGC CACAGGTTCC TCCTACTACG 781 GTGTTGTACG GCCGTGGGAC CGGCGTCAAA GGGCCTGCCT GCACGCCTTC CCGCTGACGT 841 CGACTCCCCT CAGCAGCCCT GTGTACTGCC TGCGTCTCAC CACCAAGCAT CTCTATGCTG 901 CCCTGTCTTA CAACCTCCAC GTCCTGGATT TTCAAAACCC ATGCCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGATCC TCATGACACG CCACCTTTGC GACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t