Transcript: Human XM_005270053.3

PREDICTED: Homo sapiens F-box and WD repeat domain containing 4 (FBXW4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXW4 (6468)
Length:
2181
CDS:
244..1554

Additional Resources:

NCBI RefSeq record:
XM_005270053.3
NBCI Gene record:
FBXW4 (6468)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010892 GCTGCTTTAGAGTGCGGCTGA pLKO.1 1776 3UTR 100% 0.720 1.008 N FBXW4 n/a
2 TRCN0000432980 AGATTGGCATTCATAAGATTC pLKO_005 794 CDS 100% 10.800 7.560 N FBXW4 n/a
3 TRCN0000415910 TGCTGGCCAACTCGCATATTG pLKO_005 752 CDS 100% 13.200 7.920 N FBXW4 n/a
4 TRCN0000433620 GATGCAGCTAGAGGATGATTC pLKO_005 612 CDS 100% 10.800 5.400 Y FBXW4 n/a
5 TRCN0000004585 CTCACCACCAAGCATCTCTAT pLKO.1 1486 CDS 100% 4.950 2.475 Y FBXW4 n/a
6 TRCN0000004586 GAAGTGGAGATGCAGTCAGAT pLKO.1 585 CDS 100% 4.950 2.475 Y FBXW4 n/a
7 TRCN0000010894 GATGAGGACGTTTGCCACTTT pLKO.1 730 CDS 100% 4.950 2.475 Y FBXW4 n/a
8 TRCN0000010893 GCCTACCAGTTCCGTCCAGAT pLKO.1 664 CDS 100% 1.350 0.675 Y FBXW4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270053.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11131 pDONR223 100% 66.8% 66.7% None 1_360del;768_839del;1160T>C n/a
2 ccsbBroad304_11131 pLX_304 0% 66.8% 66.7% V5 1_360del;768_839del;1160T>C n/a
3 TRCN0000468716 TCCTCATGACACGCCACCTTTGCG pLX_317 38.8% 66.8% 66.7% V5 1_360del;768_839del;1160T>C n/a
Download CSV