Transcript: Mouse XR_386482.3

PREDICTED: Mus musculus F-box and WD-40 domain protein 4 (Fbxw4), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fbxw4 (30838)
Length:
2137
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386482.3
NBCI Gene record:
Fbxw4 (30838)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000012821 TGTACCTATCACAGGCTAATT pLKO.1 888 3UTR 100% 13.200 9.240 N Fbxw4 n/a
2 TRCN0000280182 TGTACCTATCACAGGCTAATT pLKO_005 888 3UTR 100% 13.200 9.240 N Fbxw4 n/a
3 TRCN0000012818 CTGTGCTCTTAGGAGAATGTA pLKO.1 1772 3UTR 100% 5.625 3.938 N Fbxw4 n/a
4 TRCN0000280125 CTGTGCTCTTAGGAGAATGTA pLKO_005 1772 3UTR 100% 5.625 3.938 N Fbxw4 n/a
5 TRCN0000012819 GCACTTCTCACCTCTGAGAAT pLKO.1 1202 3UTR 100% 0.495 0.347 N Fbxw4 n/a
6 TRCN0000280180 GCACTTCTCACCTCTGAGAAT pLKO_005 1202 3UTR 100% 0.495 0.347 N Fbxw4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386482.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11131 pDONR223 100% 28.2% None (many diffs) n/a
2 ccsbBroad304_11131 pLX_304 0% 28.2% V5 (many diffs) n/a
3 TRCN0000468716 TCCTCATGACACGCCACCTTTGCG pLX_317 38.8% 28.2% V5 (many diffs) n/a
Download CSV