Construct: ORF TRCN0000468742
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006521.1_s317c1
- Derived from:
- ccsbBroadEn_13974
- DNA Barcode:
- TAGGCCAGTGGCTAGTGGCCCCAT
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TYR (7299)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468742
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7299 | TYR | tyrosinase | XM_011542970.2 | 76.3% | 73.9% | (many diffs) |
| 2 | human | 7299 | TYR | tyrosinase | NM_000372.5 | 68% | 65.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1197
- ORF length:
- 1131
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct cctggctctt ttgtactgcc tgctgtggag tttccagacc tccgctggcc 121 atttccctag agcctgtgtc tcctctaaga acctgatgga gaaggaatgc tgtccaccgt 181 ggagcgggga caggagtccc tgtggccagc tttcaggcag aggttcctgt cagaatatcc 241 ttctgtccaa tgcaccactt gggcctcaat ttcccttcac aggggtggat gaccgggagt 301 cgtggccttc cgtcttttat aataggacct gccagtgctc tggcaacttc atgggattca 361 actgtggaaa ctgcaagttt ggcttttggg gaccaaactg cacagagaga cgactcttgg 421 tgagaagaaa catcttcgat ttgagtgccc cagagaagga caaatttttt gcctacctca 481 ctttagcaaa gcataccatc agctcagact atgtcatccc catagggacc tatggccaaa 541 tgaaaaatgg atcaacaccc atgtttaacg acatcaatat ttatgacctc tttgtctgga 601 tgcattatta tgtgtcaatg gatgcactgc ttgggggatc tgaaatctgg agagacattg 661 attttgccca tgaagcacca gcttttctgc cttggcatag actcttcttg ttgcggtggg 721 aacaagaaat ccagaagctg acaggagatg aaaacttcac tattccatat tGGGACTGGC 781 GGGATGCAGA AAAGTGTGAC ATTTGCACAG ATGAGTACAT GGGAGGTCAG CACCCCACAA 841 ATCCTAACTT ACTCAGCCCA GCATCATTCT TCTCCTCTTG GCAGATTGTC TGTAGCCGAT 901 TGGAGGAGTA CAACAGCCAT CAGTCTTTAT GCAATGGAAC GCCCGAGGGA CCTTTACGGC 961 GTAATCCTGG AAACCATGAC AAATCCAGAA CCCCAAGGCT CCCCTCTTCA GCTGATGTAG 1021 AATTTTGCCT GAGTTTGACC CAATATGAAT CTGGTTCCAT GGATAAAGCT GCCAATTTCA 1081 GCTTTAGAAA TACACTGGAA GAGATGGGAT TTCTCCATGT TGGCTGGGCT GGTCTCAAAC 1141 TCCTGACCTC AAGAGATCCA CCACCTTGGC CTCCCAAAAT GCTGGGATAC AGGCTTGCCC 1201 AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT 1261 CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA 1321 TATATCTTGT GGAAAGGACG ATAGGCCAGT GGCTAGTGGC CCCATACGCG TTAAGTCgac 1381 aatcaacctc tggattacaa aatttgtgaa agatt