Transcript: Human XM_011542970.2

PREDICTED: Homo sapiens tyrosinase (TYR), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TYR (7299)
Length:
1934
CDS:
390..1805

Additional Resources:

NCBI RefSeq record:
XM_011542970.2
NBCI Gene record:
TYR (7299)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373918 AGACTACATTAAGTCCTATTT pLKO_005 1866 3UTR 100% 13.200 9.240 N TYR n/a
2 TRCN0000083538 CCCATGTTTAACGACATCAAT pLKO.1 882 CDS 100% 5.625 3.938 N TYR n/a
3 TRCN0000083541 GCCTTGCACATCTATATGAAT pLKO.1 1482 CDS 100% 5.625 3.938 N TYR n/a
4 TRCN0000083539 GCCTTGGCATAGACTCTTCTT pLKO.1 1013 CDS 100% 4.950 3.465 N TYR n/a
5 TRCN0000083540 CCATTGGACATAACCGGGAAT pLKO.1 1639 CDS 100% 4.050 2.835 N TYR n/a
6 TRCN0000083542 CTCTGGCAACTTCATGGGATT pLKO.1 662 CDS 100% 4.050 2.835 N TYR n/a
7 TRCN0000373833 TGCCTGAGTTTGACCCAATAT pLKO_005 1350 CDS 100% 13.200 7.920 N TYR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542970.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13974 pDONR223 100% 76.3% 73.9% None (many diffs) n/a
2 ccsbBroad304_13974 pLX_304 0% 76.3% 73.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000468742 TAGGCCAGTGGCTAGTGGCCCCAT pLX_317 37.8% 76.3% 73.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV