Construct: ORF TRCN0000468777
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007064.1_s317c1
- Derived from:
- ccsbBroadEn_13914
- DNA Barcode:
- TTCCACGGGCATGTGATTCGCGGG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NPY1R (4886)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468777
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | NM_000909.6 | 99.9% | 98.6% | 1137delT |
| 2 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | XM_005263031.4 | 99.9% | 98.6% | 1137delT |
| 3 | human | 4886 | NPY1R | neuropeptide Y receptor Y1 | XM_011532010.3 | 99.9% | 98.6% | 1137delT |
| 4 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | NM_010934.4 | 85.1% | 92.4% | (many diffs) |
| 5 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509594.3 | 85.1% | 92.4% | (many diffs) |
| 6 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509595.3 | 85.1% | 92.4% | (many diffs) |
| 7 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_006509596.3 | 85.1% | 92.4% | (many diffs) |
| 8 | mouse | 18166 | Npy1r | neuropeptide Y receptor Y1 | XM_017312614.1 | 85.1% | 92.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1218
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ttcaacatta ttttcccagg ttgaaaatca ttcagtccac tctaatttct 121 cagagaagaa tgcccagctt ctggcttttg aaaatgatga ttgtcatctg cccttggcca 181 tgatatttac cttagctctt gcttatggag ctgtgatcat tcttggtgtc tctggaaacc 241 tggccttgat cataatcatc ttgaaacaaa aggagatgag aaatgttacc aacatcctga 301 ttgtgaacct ttccttctca gacttgcttg ttgccatcat gtgtctcccc tttacatttg 361 tctacacatt aatggaccac tgggtctttg gtgaggcgat gtgtaagttg aatccttttg 421 tgcaatgtgt ttcaatcact gtgtccattt tctctctggt tctcattgct gtggaacgac 481 atcagctgat aatcaaccct cgagggtgga gaccaaataa tagacatgct tatgtaggta 541 ttgctgtgat ttgggtcctt gctgtggctt cttctttgcc tttcctgatc taccaagtaa 601 tgactgatga gccgttccaa aatgtaacac ttgatgcgta caaagacaaa tacgtgtgct 661 ttgatcaatt tccatcggac tctcataggt tgtcttatac cactctcctc ttggtgctgc 721 agtattttgg tccactttgt tttatattta tttgcTACTT CAAGATATAT ATACGCCTAA 781 AAAGGAGAAA CAACATGATG GACAAGATGA GAGACAATAA GTACAGGTCC AGTGAAACCA 841 AAAGAATCAA TATCATGCTG CTCTCCATTG TGGTAGCATT TGCAGTCTGC TGGCTCCCTC 901 TTACCATCTT TAACACTGTG TTTGATTGGA ATCATCAGAT CATTGCTACC TGCAACCACA 961 ATCTGTTATT CCTGCTCTGC CACCTCACAG CAATGATATC CACTTGTGTC AACCCCATAT 1021 TTTATGGGTT CCTGAACAAA AACTTCCAGA GAGACTTGCA GTTCTTCTTC AACTTTTGTG 1081 ATTTCCGGTC TCGGGATGAT GATTATGAAA CAATAGCCAT GTCCACGATG CACACAGATG 1141 TTTCCAAAAC TTCTTTGAAG CAAGCAAGCC CAGTCGCATT TAAAAAAATC AACAACAATG 1201 AGATAATGAA AAAATCTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG GTAAGCCTAT 1261 CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT AACTTGAAAG 1321 TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATTCCACGG GCATGTGATT 1381 CGCGGGACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga aagatt