Transcript: Mouse NM_010934.4

Mus musculus neuropeptide Y receptor Y1 (Npy1r), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Npy1r (18166)
Length:
3007
CDS:
249..1397

Additional Resources:

NCBI RefSeq record:
NM_010934.4
NBCI Gene record:
Npy1r (18166)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220306 CCCTTTGTGATCTATCAAATT pLKO.1 759 CDS 100% 13.200 18.480 N Npy1r n/a
2 TRCN0000220310 GCGGCGTTCAAGGACAAGTAT pLKO.1 813 CDS 100% 5.625 7.875 N Npy1r n/a
3 TRCN0000220308 CCTGGCATTGATCATAATCAT pLKO.1 419 CDS 100% 5.625 4.500 N Npy1r n/a
4 TRCN0000220307 CCACTCTGCTTTATATTCATA pLKO.1 912 CDS 100% 5.625 3.938 N Npy1r n/a
5 TRCN0000220309 CCAGAGAGACTTGCAGTTCTT pLKO.1 1226 CDS 100% 4.950 3.465 N Npy1r n/a
6 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 2272 3UTR 100% 4.950 2.475 Y Gad2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010934.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13914 pDONR223 100% 85.1% 92.4% None (many diffs) n/a
2 ccsbBroad304_13914 pLX_304 0% 85.1% 92.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000468777 TTCCACGGGCATGTGATTCGCGGG pLX_317 40.3% 85.1% 92.4% V5 (not translated due to frame shift) (many diffs) n/a
4 TRCN0000492115 AAAAAGCATTTAGGGCAATGCGTC pLX_317 36.3% 85% 93.4% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489342 TGTCCTAGTTTAGGCCCAGTAGTA pLX_317 21.6% 84.9% 93.2% V5 (many diffs) n/a
Download CSV