Transcript: Human XM_005263031.4

PREDICTED: Homo sapiens neuropeptide Y receptor Y1 (NPY1R), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NPY1R (4886)
Length:
3095
CDS:
680..1834

Additional Resources:

NCBI RefSeq record:
XM_005263031.4
NBCI Gene record:
NPY1R (4886)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005263031.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357589 TGCCATCCAATACGGTCATTA pLKO_005 2170 3UTR 100% 13.200 18.480 N NPY1R n/a
2 TRCN0000009212 CGGACTCTCATAGGTTGTCTT pLKO.1 1290 CDS 100% 4.950 3.960 N NPY1R n/a
3 TRCN0000357663 AGCAAGCCCAGTCGCATTTAA pLKO_005 1777 CDS 100% 15.000 10.500 N NPY1R n/a
4 TRCN0000009209 CCCAACTGATTGTCACTTAAA pLKO.1 2423 3UTR 100% 13.200 9.240 N NPY1R n/a
5 TRCN0000368499 GAAACCTGGCCTTGATCATAA pLKO_005 849 CDS 100% 13.200 9.240 N NPY1R n/a
6 TRCN0000009213 GCCACCTCACAGCAATGATAT pLKO.1 1593 CDS 100% 13.200 9.240 N NPY1R n/a
7 TRCN0000009210 GCTCCCTCTTACCATCTTTAA pLKO.1 1507 CDS 100% 13.200 9.240 N NPY1R n/a
8 TRCN0000009211 CCACTCTAATTTCTCAGAGAA pLKO.1 721 CDS 100% 4.950 3.465 N NPY1R n/a
9 TRCN0000220309 CCAGAGAGACTTGCAGTTCTT pLKO.1 1660 CDS 100% 4.950 2.970 N Npy1r n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005263031.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13914 pDONR223 100% 99.9% 98.6% None 1137delT n/a
2 ccsbBroad304_13914 pLX_304 0% 99.9% 98.6% V5 (not translated due to frame shift) 1137delT n/a
3 TRCN0000468777 TTCCACGGGCATGTGATTCGCGGG pLX_317 40.3% 99.9% 98.6% V5 (not translated due to frame shift) 1137delT n/a
4 TRCN0000492115 AAAAAGCATTTAGGGCAATGCGTC pLX_317 36.3% 99.9% 100% V5 (not translated due to prior stop codon) 75T>C n/a
5 TRCN0000489342 TGTCCTAGTTTAGGCCCAGTAGTA pLX_317 21.6% 99.8% 99.7% V5 75T>C;1152_1153insG n/a
Download CSV