Construct: ORF TRCN0000468833
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016923.1_s317c1
- Derived from:
- ccsbBroadEn_09068
- DNA Barcode:
- ACATGTTAGATAAACGGACCAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GDPD5 (81544)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468833
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | NM_030792.8 | 99.8% | 99.6% | 555C>T;953A>T;1438G>A |
| 2 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_006718697.3 | 99.8% | 99.6% | 555C>T;953A>T;1438G>A |
| 3 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545276.2 | 99.6% | 99.5% | (many diffs) |
| 4 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545277.2 | 99.6% | 99.5% | (many diffs) |
| 5 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545278.2 | 99.6% | 99.5% | (many diffs) |
| 6 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545279.2 | 99.6% | 99.5% | (many diffs) |
| 7 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545280.1 | 86.7% | 74.6% | (many diffs) |
| 8 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | NM_001351167.1 | 77% | 76.8% | (many diffs) |
| 9 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545281.2 | 76.8% | 76.7% | (many diffs) |
| 10 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | NM_001351168.1 | 59.3% | 59.1% | 0_1ins735;218A>T;703G>A |
| 11 | human | 81544 | GDPD5 | glycerophosphodiester phosp... | XM_011545286.1 | 59.2% | 59% | (many diffs) |
| 12 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | NM_201352.2 | 87.5% | 90.4% | (many diffs) |
| 13 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_017322181.1 | 87.5% | 90.4% | (many diffs) |
| 14 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507632.1 | 86.8% | 89.5% | (many diffs) |
| 15 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507633.1 | 86.8% | 89.5% | (many diffs) |
| 16 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507634.1 | 86.8% | 89.5% | (many diffs) |
| 17 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_011241738.1 | 86.8% | 89.5% | (many diffs) |
| 18 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507635.1 | 83.8% | 86.6% | (many diffs) |
| 19 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507636.1 | 78.6% | 75.9% | (many diffs) |
| 20 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507637.1 | 75.4% | 77.2% | (many diffs) |
| 21 | mouse | 233552 | Gdpd5 | glycerophosphodiester phosp... | XM_006507639.1 | 46.5% | 47.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1881
- ORF length:
- 1815
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gagacaccag cccctgcagt actacgagcc acagctgtgc ctctcctgcc 121 tcacgggcat ctacggctgc cgttggaagc gctaccagcg ctcccatgat gataccacac 181 cgtgggagcg cctctggttc ctgctcctca ccttcacctt tggcctcacg ctcacctggc 241 tttacttctg gtgggaagtc cacaatgact atgatgaatt caactggtac ctctacaacc 301 gcatgggcta ctggagcgac tggcccgtac ccatccttgt gaccacagct gctgccttcg 361 catacatcgc tggcctcctg gtcctggcac tatgtcacat tgccgtgggg cagcagatga 421 acctgcactg gctgcacaag atcgggctgg tggtcatcct ggcttccacg gtggtggcca 481 tgtcggccgt ggcccagctg tgggaggacg agtgggaggt gctgctgatc tccctgcagg 541 gcacagcgcc attcctgcat gtgggggctg tggcagcagt caccatgctc tcctggatcg 601 tggcaggaca gttcgcccgt gcagagcgga cctcctccca ggtgaccatt ctctgtacct 661 tcttcaccgt ggtgtttgcc ctctacctgg cccctctcac catctcctct ccctgcatca 721 tggagaagaa agacctcggc cccaagcctg ctctcattgg ccaccgcggg gcccccatgc 781 tggctccaga gcacacgctc atgtccttcc ggaaggccct cgagcagaag ctgtacgggc 841 tccaggctga cattaccatc agcctggacg gcgtgccctt cctcatgcat gacaccaccc 901 tgcggcgcac caccaacgtg gaggaggagt tcccggagct ggcccgcagg cctgcctcca 961 tgcttaactg gaccaccctg cagagactca acgctggcca gtggttcctg aagactgtcc 1021 ccttctggac agccagctcc ctgtcaccct ccgaccacag agaggcccag aaccagtcca 1081 tctgcagcct ggcagagctc ctggagctgg ccaagggcaa tgccacactg ctgctcaacc 1141 tgcgtgaccc gccccgggag cacccctacc gcagcagttt tatcaacgtg actctggagg 1201 ccgtgctgca ctccggcttc ccccagcacc aggtcatgtg gctgcctagc aggcagaggc 1261 ccctggtgcg gaaggtggct cccggcttcc aacagacatc aggctccaag gaggcagtcg 1321 ccagcctgcg gagaggccac atccagcggc tgaacctgcg ctacactcag gtgtcccgcc 1381 aggagctcag ggactacgcg tcctggaacc tgagtgtgaa cctctacaca gtcaacgcac 1441 cgtggctctt ctccctgctg tggtgtgcgg gggtcccatc cgtcaccTCT GACAACTCCC 1501 ACACCCTGTC CCAGGTGCCT TCCCCCCTCT GGATCATGCC CCCGGACGAG TACTGTCTCA 1561 TGTGGGTCAC TGCCGACCTG GTCTCCTTCA CCCTCATCGT GGGCATCTTC GTGCTCCAGA 1621 AGTGGCGCCT GGGTGGCATA CGGAGCTACA ACCCTGAGCA GATCATGCTG AGTGCTGCGG 1681 TGCGCCGGAC CAGCCGGGAC GTCAGCATCA TGAAGGAGAA GCTTATTTTC TCAGAGATCA 1741 GCGATGGTGT AGAGGTCTCC GATGTGCTCT CCGTATGTTC AGACAACAGT TATGACACAT 1801 ATGCCAACAG CACCGCCACC CCTGTGGGCC CCCGAGGGGG TGGCAGCCAC ACCAAGACCC 1861 TCATAGAGCG GAGTGGGCGT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1921 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1981 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACAT GTTAGATAAA 2041 CGGACCAACC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt