Transcript: Mouse XM_006507637.1

PREDICTED: Mus musculus glycerophosphodiester phosphodiesterase domain containing 5 (Gdpd5), transcript variant X8, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gdpd5 (233552)
Length:
3555
CDS:
1083..2684

Additional Resources:

NCBI RefSeq record:
XM_006507637.1
NBCI Gene record:
Gdpd5 (233552)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257552 ACGGCACCATTCCTGCATATA pLKO_005 1323 CDS 100% 13.200 18.480 N Gdpd5 n/a
2 TRCN0000248532 AGTTACGACACCTATGCTAAT pLKO_005 2583 CDS 100% 10.800 15.120 N Gdpd5 n/a
3 TRCN0000217683 GTTACGACACCTATGCTAATG pLKO.1 2584 CDS 100% 10.800 15.120 N Gdpd5 n/a
4 TRCN0000248529 ACCAGGTCATGTGGCTATTTA pLKO_005 2008 CDS 100% 15.000 12.000 N Gdpd5 n/a
5 TRCN0000248531 ATGCCCACACCTCTCTATTTA pLKO_005 3062 3UTR 100% 15.000 10.500 N Gdpd5 n/a
6 TRCN0000217135 CCAGGTCATGTGGCTATTTAA pLKO.1 2009 CDS 100% 15.000 10.500 N Gdpd5 n/a
7 TRCN0000248530 CTGGGTGGTATACGGAGTTAC pLKO_005 2424 CDS 100% 10.800 7.560 N Gdpd5 n/a
8 TRCN0000190158 GCCATCGCTAACTTACGGAAA pLKO.1 2094 CDS 100% 4.050 2.835 N Gdpd5 n/a
9 TRCN0000005174 GCTCTCCGTATGTTCAGACAA pLKO.1 2561 CDS 100% 4.950 3.960 N GDPD5 n/a
10 TRCN0000315000 TCCTGGCACTATGTCACATTG pLKO_005 1162 CDS 100% 10.800 7.560 N GDPD5 n/a
11 TRCN0000005177 GTCCTGGCACTATGTCACATT pLKO.1 1161 CDS 100% 4.950 3.465 N GDPD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507637.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09068 pDONR223 100% 75.4% 77.2% None (many diffs) n/a
2 ccsbBroad304_09068 pLX_304 0% 75.4% 77.2% V5 (many diffs) n/a
3 TRCN0000468833 ACATGTTAGATAAACGGACCAACC pLX_317 22% 75.4% 77.2% V5 (many diffs) n/a
4 ccsbBroadEn_12716 pDONR223 100% 63.6% 66% None (many diffs) n/a
5 ccsbBroad304_12716 pLX_304 0% 63.6% 66% V5 (many diffs) n/a
6 TRCN0000469124 CGGGCATAGTATAGTCCTGTTATT pLX_317 30.5% 63.6% 66% V5 (many diffs) n/a
Download CSV