Transcript: Human XM_011545280.1

PREDICTED: Homo sapiens glycerophosphodiester phosphodiesterase domain containing 5 (GDPD5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GDPD5 (81544)
Length:
2872
CDS:
356..2005

Additional Resources:

NCBI RefSeq record:
XM_011545280.1
NBCI Gene record:
GDPD5 (81544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545280.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314931 AGCTGCTGCCTTCGCATACAT pLKO_005 311 5UTR 100% 5.625 7.875 N GDPD5 n/a
2 TRCN0000005174 GCTCTCCGTATGTTCAGACAA pLKO.1 1888 CDS 100% 4.950 3.960 N GDPD5 n/a
3 TRCN0000314929 GTATGTTCAGACAACAGTTAT pLKO_005 1895 CDS 100% 13.200 9.240 N GDPD5 n/a
4 TRCN0000315000 TCCTGGCACTATGTCACATTG pLKO_005 346 5UTR 100% 10.800 7.560 N GDPD5 n/a
5 TRCN0000314998 TCTGGTGGGAAGTCCACAATG pLKO_005 211 5UTR 100% 10.800 7.560 N GDPD5 n/a
6 TRCN0000005177 GTCCTGGCACTATGTCACATT pLKO.1 345 5UTR 100% 4.950 3.465 N GDPD5 n/a
7 TRCN0000005173 CCTGGTAGAAGTGTTCTGGAT pLKO.1 2766 3UTR 100% 2.640 1.848 N GDPD5 n/a
8 TRCN0000314928 CCTGGTAGAAGTGTTCTGGAT pLKO_005 2766 3UTR 100% 2.640 1.848 N GDPD5 n/a
9 TRCN0000005175 CCACAATGACTATGATGAATT pLKO.1 224 5UTR 100% 0.000 0.000 N GDPD5 n/a
10 TRCN0000005176 GACAACAGTTATGACACATAT pLKO.1 1904 CDS 100% 13.200 7.920 N GDPD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545280.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09068 pDONR223 100% 86.7% 74.6% None (many diffs) n/a
2 ccsbBroad304_09068 pLX_304 0% 86.7% 74.6% V5 (many diffs) n/a
3 TRCN0000468833 ACATGTTAGATAAACGGACCAACC pLX_317 22% 86.7% 74.6% V5 (many diffs) n/a
4 ccsbBroadEn_12716 pDONR223 100% 70.4% 70.3% None 1_483del;1267G>A;1496_1498delCAG n/a
5 ccsbBroad304_12716 pLX_304 0% 70.4% 70.3% V5 1_483del;1267G>A;1496_1498delCAG n/a
6 TRCN0000469124 CGGGCATAGTATAGTCCTGTTATT pLX_317 30.5% 70.4% 70.3% V5 1_483del;1267G>A;1496_1498delCAG n/a
Download CSV