Construct: ORF TRCN0000468841
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001027.1_s317c1
- Derived from:
- ccsbBroadEn_09088
- DNA Barcode:
- AATTCAACTGCACTCTAAGTGTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPACA1 (81833)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468841
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 81833 | SPACA1 | sperm acrosome associated 1 | NM_030960.3 | 99.8% | 100% | 774T>C |
| 2 | human | 81833 | SPACA1 | sperm acrosome associated 1 | XM_011536160.2 | 71.9% | 72.1% | 0_1ins246;528T>C |
| 3 | human | 81833 | SPACA1 | sperm acrosome associated 1 | XM_017011335.1 | 71.9% | 72.1% | 0_1ins246;528T>C |
| 4 | human | 81833 | SPACA1 | sperm acrosome associated 1 | XR_241854.5 | 52.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 948
- ORF length:
- 882
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag ccccaggggc acgggctgct ccgccgggct gctgatgact gtcggctggc 121 tgcttctggc gggcctccag tccgcgcgcg ggaccaacgt caccgctgcc gtccaggatg 181 ccggcctggc ccacgaaggc gagggcgagg aggagaccga aaacaacgac agcgagaccg 241 cggagaacta cgctccgcct gaaaccgagg atgtttcaaa taggaatgtc gtcaaagaag 301 tagaattcgg aatgtgcacc gttacatgtg gtattggtgt tagagaagtt atattaacaa 361 atggatgccc tggtggtgaa tccaagtgtg ttgtacgggt agaagaatgc cgtggaccaa 421 cagattgtgg ctggggtaaa ccaatttcag aaagtcttga aagtgttaga ttggcatgta 481 ttcacacatc tcccttaaat cgtttcaaat atatgtggaa acttctaaga caagaccaac 541 aatccattat acttgtaaat gattcagcaa TCCTAGAAGT ACGCAAGGAA AGTCACCCCT 601 TGGCTTTCGA GTGTGACACA CTGGATAATA ATGAAATAGT AGCAACTATT AAATTCACAG 661 TCTATACGAG CAGTGAATTG CAGATGAGAA GATCAAGCCT ACCAGCCACT GATGCAGCCC 721 TAATTTTTGT GCTGACCATA GGAGTCATTA TCTGTGTATT TATAATTTTC TTATTGATCT 781 TCATAATCAT AAATTGGGCA GCAGTCAAGG CTTTCTGGGG GGCAAAAGCC TCTACACCCG 841 AGGTACAATC CGAGCAGAGT TCTGTGAGAT ACAAAGATTC AACTTCTCTT GACCAATTAC 901 CAACAGAAAT GCCTGGTGAA GATGATGCTT TAAGTGAATG GAATGAATGC CCAACTTTCT 961 TGTACAAAGT GGTTGATATC GGTAAGCCTA TCCCTAACCC TCTCCTCGGT CTCGATTCTA 1021 CGTAGTAATG AACTAGTCCG TAACTTGAAA GTATTTCGAT TTCTTGGCTT TATATATCTT 1081 GTGGAAAGGA CGAAATTCAA CTGCACTCTA AGTGTACACG CGTTAAGTCg acaatcaacc 1141 tctggattac aaaatttgtg aaagatt