Transcript: Human XR_241854.5

PREDICTED: Homo sapiens sperm acrosome associated 1 (SPACA1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPACA1 (81833)
Length:
1689
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_241854.5
NBCI Gene record:
SPACA1 (81833)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_241854.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141103 CCACTGATGCAGCCCTAATTT pLKO.1 1357 3UTR 100% 15.000 21.000 N SPACA1 n/a
2 TRCN0000143040 GAGTGTGACACACTGGATAAT pLKO.1 1241 3UTR 100% 13.200 18.480 N SPACA1 n/a
3 TRCN0000143991 CTTGACCAATTACCAACAGAA pLKO.1 1539 3UTR 100% 4.950 6.930 N SPACA1 n/a
4 TRCN0000144313 CGAGGATGTTTCAAATAGGAA pLKO.1 898 3UTR 100% 3.000 2.400 N SPACA1 n/a
5 TRCN0000415747 ATTCACACATCTCCCTTAAAT pLKO_005 1112 3UTR 100% 15.000 10.500 N SPACA1 n/a
6 TRCN0000413244 TTGGTGTTAGAGAAGTTATAT pLKO_005 966 3UTR 100% 15.000 10.500 N SPACA1 n/a
7 TRCN0000143269 GCTGACCATAGGAGTCATTAT pLKO.1 1382 3UTR 100% 13.200 9.240 N SPACA1 n/a
8 TRCN0000143797 GCAGAGTTCTGTGAGATACAA pLKO.1 1505 3UTR 100% 5.625 3.938 N SPACA1 n/a
9 TRCN0000142607 GCCTGGTGAAGATGATGCTTT pLKO.1 1562 3UTR 100% 4.950 3.465 N SPACA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_241854.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09088 pDONR223 100% 52.1% None (many diffs) n/a
2 ccsbBroad304_09088 pLX_304 0% 52.1% V5 (many diffs) n/a
3 TRCN0000468841 AATTCAACTGCACTCTAAGTGTAC pLX_317 43% 52.1% V5 (many diffs) n/a
Download CSV