Transcript: Human NM_030960.3

Homo sapiens sperm acrosome associated 1 (SPACA1), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
SPACA1 (81833)
Length:
1453
CDS:
66..950

Additional Resources:

NCBI RefSeq record:
NM_030960.3
NBCI Gene record:
SPACA1 (81833)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_030960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000141103 CCACTGATGCAGCCCTAATTT pLKO.1 706 CDS 100% 15.000 21.000 N SPACA1 n/a
2 TRCN0000143040 GAGTGTGACACACTGGATAAT pLKO.1 609 CDS 100% 13.200 18.480 N SPACA1 n/a
3 TRCN0000143991 CTTGACCAATTACCAACAGAA pLKO.1 888 CDS 100% 4.950 6.930 N SPACA1 n/a
4 TRCN0000144313 CGAGGATGTTTCAAATAGGAA pLKO.1 266 CDS 100% 3.000 2.400 N SPACA1 n/a
5 TRCN0000415747 ATTCACACATCTCCCTTAAAT pLKO_005 480 CDS 100% 15.000 10.500 N SPACA1 n/a
6 TRCN0000413244 TTGGTGTTAGAGAAGTTATAT pLKO_005 334 CDS 100% 15.000 10.500 N SPACA1 n/a
7 TRCN0000143269 GCTGACCATAGGAGTCATTAT pLKO.1 731 CDS 100% 13.200 9.240 N SPACA1 n/a
8 TRCN0000419306 TGATAACTTCTTAGGTGATTT pLKO_005 1233 3UTR 100% 13.200 9.240 N SPACA1 n/a
9 TRCN0000143797 GCAGAGTTCTGTGAGATACAA pLKO.1 854 CDS 100% 5.625 3.938 N SPACA1 n/a
10 TRCN0000122110 CTCAACACTTATTTCAGGTAA pLKO.1 1148 3UTR 100% 4.950 3.465 N SPACA1 n/a
11 TRCN0000142607 GCCTGGTGAAGATGATGCTTT pLKO.1 911 CDS 100% 4.950 3.465 N SPACA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_030960.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09088 pDONR223 100% 99.8% 100% None 774T>C n/a
2 ccsbBroad304_09088 pLX_304 0% 99.8% 100% V5 774T>C n/a
3 TRCN0000468841 AATTCAACTGCACTCTAAGTGTAC pLX_317 43% 99.8% 100% V5 774T>C n/a
Download CSV