Construct: ORF TRCN0000468973
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006206.1_s317c1
- Derived from:
- ccsbBroadEn_03258
- DNA Barcode:
- TCCTGCGATACCTTAGGACGACTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- MARCHF2 (51257)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468973
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_001005415.1 | 100% | 100% | |
| 2 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_001369776.1 | 100% | 100% | |
| 3 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_001369777.1 | 100% | 100% | |
| 4 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_001369778.1 | 100% | 100% | |
| 5 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_001369779.1 | 100% | 100% | |
| 6 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_016496.5 | 100% | 100% | |
| 7 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NM_001005416.2 | 71.5% | 71.5% | 371_372ins210 |
| 8 | human | 51257 | MARCHF2 | membrane associated ring-CH... | NR_163145.1 | 39.2% | 1_168del;341_342ins196;711_1184del | |
| 9 | mouse | 224703 | March2 | membrane-associated ring fi... | NM_001252480.1 | 84.7% | 94.7% | (many diffs) |
| 10 | mouse | 224703 | March2 | membrane-associated ring fi... | NM_145486.5 | 72% | 79% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 807
- ORF length:
- 738
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacgacgggt gactgctgcc acctccccgg ctccctgtgt gactgctccg 121 gcagccctgc cttctccaag gtcgtggagg ctacgggcct cggaccgccc cagtatgtgg 181 cacaggtgac ttcaagggat ggccggctcc tctccaccgt catccgtgcc ttggacacac 241 cgagtgatgg tcctttctgc cggatctgcc atgagggagc gaacggggag tgcttgctgt 301 ccccgtgtgg ctgcaccggc acgctgggtg ccgtgcataa gagctgtctg gagaagtggc 361 tttcctcatc taacaccagc tactgcgagc tgtgccacac ggagtttgca gtggagaaac 421 ggcctcgacc cctcacagag tggctgaagg acccgggGCC GCGGACGGAG AAGCGGACAC 481 TGTGCTGCGA CATGGTGTGT TTCCTGTTCA TCACACCGCT GGCCGCCATC TCAGGCTGGT 541 TGTGCCTGCG CGGGGCCCAG GACCACCTCC GGCTCCACAG CCAGCTGGAG GCCGTGGGTC 601 TCATTGCCCT CACCATCGCC CTCTTCACCA TCTATGTCCT CTGGACGCTG GTCTCCTTCC 661 GCTACCACTG CCAGCTGTAC TCCGAGTGGA GAAAGACCAA CCAGAAAGTT CGCCTGAAGA 721 TCCGGGAGGC GGACAGCCCC GAGGGCCCCC AGCATTCTCC ACTGGCAGCT GGACTCCTGA 781 AGAAGGTGGC AGAGGAGACA CCAGTATTGC CAACTTTCTT GTACAAAGTG GTTGATATCG 841 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 901 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATCCTGCGA 961 TACCTTAGGA CGACTCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1021 aagatt