Transcript: Mouse NM_145486.5

Mus musculus membrane-associated ring finger (C3HC4) 2 (March2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
March2 (224703)
Length:
3452
CDS:
185..1048

Additional Resources:

NCBI RefSeq record:
NM_145486.5
NBCI Gene record:
March2 (224703)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_145486.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126186 GCCACCTCAATATGTAGCACA pLKO.1 280 CDS 100% 2.640 3.696 N March2 n/a
2 TRCN0000126187 TGGTCTCTTTCCGATACCATT pLKO.1 765 CDS 100% 4.950 3.960 N March2 n/a
3 TRCN0000126185 GCTGGCTACTGGACTCTTAAA pLKO.1 877 CDS 100% 13.200 9.240 N March2 n/a
4 TRCN0000126188 CTGGTCTCTTTCCGATACCAT pLKO.1 764 CDS 100% 3.000 2.100 N March2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_145486.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03258 pDONR223 100% 72% 79% None (many diffs) n/a
2 ccsbBroad304_03258 pLX_304 0% 72% 79% V5 (many diffs) n/a
3 TRCN0000468973 TCCTGCGATACCTTAGGACGACTC pLX_317 47.3% 72% 79% V5 (many diffs) n/a
Download CSV