Transcript: Human NM_016496.5

Homo sapiens membrane associated ring-CH-type finger 2 (MARCHF2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-10
Taxon:
Homo sapiens (human)
Gene:
MARCHF2 (51257)
Length:
1651
CDS:
440..1180

Additional Resources:

NCBI RefSeq record:
NM_016496.5
NBCI Gene record:
MARCHF2 (51257)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_016496.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438090 CTGTACTCCGAGTGGAGAAAG pLKO_005 1046 CDS 100% 10.800 15.120 N MARCHF2 n/a
2 TRCN0000437121 AGCAAGCTTCTTGCGCTTCTC pLKO_005 1523 3UTR 100% 4.050 5.670 N MARCHF2 n/a
3 TRCN0000036995 GCATAAGAGCTGTCTGGAGAA pLKO.1 706 CDS 100% 4.050 5.670 N MARCHF2 n/a
4 TRCN0000437999 TCGCCCTCTTCACCATCTATG pLKO_005 987 CDS 100% 10.800 7.560 N MARCHF2 n/a
5 TRCN0000036994 CCAGAAAGTTCGCCTGAAGAT pLKO.1 1072 CDS 100% 4.950 3.465 N MARCHF2 n/a
6 TRCN0000441349 GCGCCCTTAAAGCTGGAACAT pLKO_005 1499 3UTR 100% 4.950 3.465 N MARCHF2 n/a
7 TRCN0000036997 CCGGCTCCTCTCCACCGTCAT pLKO.1 574 CDS 100% 0.000 0.000 N MARCHF2 n/a
8 TRCN0000036996 GCGGACACTGTGCTGCGACAT pLKO.1 844 CDS 100% 0.000 0.000 N MARCHF2 n/a
9 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 233 5UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_016496.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03258 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03258 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468973 TCCTGCGATACCTTAGGACGACTC pLX_317 47.3% 100% 100% V5 n/a
Download CSV