Construct: ORF TRCN0000468986
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003171.1_s317c1
- Derived from:
- ccsbBroadEn_04824
- DNA Barcode:
- ATGAATTATAACCACCTATTCCTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ASB17 (127247)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468986
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 127247 | ASB17 | ankyrin repeat and SOCS box... | NM_080868.3 | 100% | 100% | |
| 2 | human | 127247 | ASB17 | ankyrin repeat and SOCS box... | XM_006710345.3 | 83.7% | 83.7% | 165_166ins144 |
| 3 | human | 127247 | ASB17 | ankyrin repeat and SOCS box... | NR_026546.3 | 76.2% | 1_113del;512_513ins62;937_1018del | |
| 4 | human | 127247 | ASB17 | ankyrin repeat and SOCS box... | XM_006710346.3 | 73.5% | 73.5% | 164_165ins234 |
| 5 | mouse | 66772 | Asb17 | ankyrin repeat and SOCS box... | NM_025758.4 | 84.6% | 87.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 951
- ORF length:
- 885
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgag taaatctact aaattatgtg gtaagacttc ttgtccaaga agcaatatat 121 tctgcaatct ccttgacaaa attgttaaaa gaccctccct acagtttttg ggtcagtggg 181 gatatcactg ttacgaacca aggatttaca gatcactggc aaaaattctg aggtatgtgg 241 acttggatgg ttttgacgca ctactcacag attacattgc atttgtggaa aaatcaggat 301 accgttttga agtaagtttt aacctcgact tcactgaaat atgtgtgaat acaattctgt 361 actgggtttt tgccagaaaa ggtaatcctg actttgtgga attgcttctc aagaagacaa 421 aagactatgt tcaagacaga agttgtaacc tggcactgat atggagaact ttcacaccag 481 tatactgtcc aagcccatta agtggcaTCA CACCTCTCTT TTATGTAGCT CAGACAAGAC 541 AGTCTAATAT CTTCAAAATA CTACTGCAAT ATGGAATCTT AGAAAGAGAA AAAAACCCTA 601 TCAACATTGT CTTAACAATA GTACTCTACC CTTCGAGAGT AAGAGTAATG GTTGATCGTG 661 AATTGGCTGA CATCCATGAA GATGCCAAAA CATGTTTGGT ACTATGTTCC AGAGTGCTTT 721 CTGTCATTTC AGTCAAGGAA ATAAAGACAC AGCTGAGTTT AGGAAGACAT CCAATTATTT 781 CAAATTGGTT TGATTACATT CCTTCAACAA GATACAAAGA TCCATGTGAA CTATTACATC 841 TTTGCAGACT AACCATCAGG AATCAACTAT TAACCAACAA TATGCTCCCA GATGGAATAT 901 TTTCACTTCT AATTCCTGCT CGTCTACAAA ACTATCTGAA TTTAGAAATC TACCCAACTT 961 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1021 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1081 CTTGTGGAAA GGACGAATGA ATTATAACCA CCTATTCCTG ACGCGTTAAG TCgacaatca 1141 acctctggat tacaaaattt gtgaaagatt