Transcript: Mouse NM_025758.4

Mus musculus ankyrin repeat and SOCS box-containing 17 (Asb17), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Asb17 (66772)
Length:
1048
CDS:
87..974

Additional Resources:

NCBI RefSeq record:
NM_025758.4
NBCI Gene record:
Asb17 (66772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_025758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241022 ATACTCCTCACGGACTATATT pLKO_005 279 CDS 100% 15.000 21.000 N Asb17 n/a
2 TRCN0000241018 TTAGGACGACGCCCAATTATT pLKO_005 780 CDS 100% 15.000 21.000 N Asb17 n/a
3 TRCN0000191784 GAGTTGATTGACATTCAAGAA pLKO.1 681 CDS 100% 4.950 6.930 N Asb17 n/a
4 TRCN0000200798 GCCAAGACATGTTTAATGCTA pLKO.1 705 CDS 100% 3.000 2.400 N Asb17 n/a
5 TRCN0000215832 CAAGACAGTCAAATATCTTAA pLKO.1 556 CDS 100% 13.200 9.240 N Asb17 n/a
6 TRCN0000241020 TGCTATGAACCCAGGATTTAC pLKO_005 210 CDS 100% 13.200 9.240 N Asb17 n/a
7 TRCN0000241019 TGTTCTGACAATACTACTTTA pLKO_005 629 CDS 100% 13.200 9.240 N Asb17 n/a
8 TRCN0000241021 TTACTGAAATATGCGTGAATA pLKO_005 352 CDS 100% 13.200 9.240 N Asb17 n/a
9 TRCN0000215979 CTTGTTGACAAGATAGTTAAG pLKO.1 150 CDS 100% 10.800 7.560 N Asb17 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_025758.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04824 pDONR223 100% 84.6% 87.7% None (many diffs) n/a
2 ccsbBroad304_04824 pLX_304 0% 84.6% 87.7% V5 (many diffs) n/a
3 TRCN0000468986 ATGAATTATAACCACCTATTCCTG pLX_317 50.1% 84.6% 87.7% V5 (many diffs) n/a
Download CSV