Construct: ORF TRCN0000469000
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003577.1_s317c1
- Derived from:
- ccsbBroadEn_06068
- DNA Barcode:
- CATCCCCTGTGGTCTGTCATTTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CXADR (1525)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469000
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | NM_001338.5 | 99.9% | 100% | 120A>G |
| 2 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | NM_001207066.1 | 94.6% | 93.6% | (many diffs) |
| 3 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | XM_011529476.2 | 93.4% | 92.8% | (many diffs) |
| 4 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | XM_011529477.2 | 70.9% | 52.1% | (many diffs) |
| 5 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | XM_011529478.2 | 69% | 50% | (many diffs) |
| 6 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | NM_001207063.2 | 68.9% | 51.5% | 120A>G;568_569ins262;756_757ins77 |
| 7 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | XM_011529479.1 | 68.9% | 51.5% | 120A>G;568_569ins262;756_757ins77 |
| 8 | human | 440224 | CXADRP3 | CXADR pseudogene 3 | NR_024076.1 | 65% | (many diffs) | |
| 9 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | NM_001207064.2 | 54.7% | 41.9% | 120A>G;414_415ins418;600_601ins77 |
| 10 | human | 646243 | CXADRP2 | CXADR pseudogene 2 | NR_024387.1 | 42.4% | (many diffs) | |
| 11 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | XR_001754814.1 | 24.1% | (many diffs) | |
| 12 | human | 1525 | CXADR | CXADR Ig-like cell adhesion... | NM_001207065.2 | 22.6% | 21.3% | (many diffs) |
| 13 | mouse | 13052 | Cxadr | coxsackie virus and adenovi... | NM_001025192.3 | 83.7% | 89.8% | (many diffs) |
| 14 | mouse | 13052 | Cxadr | coxsackie virus and adenovi... | XM_006522883.3 | 83.7% | 89.8% | (many diffs) |
| 15 | mouse | 13052 | Cxadr | coxsackie virus and adenovi... | NM_009988.4 | 78.7% | 83.8% | (many diffs) |
| 16 | mouse | 13052 | Cxadr | coxsackie virus and adenovi... | XM_006522884.3 | 78.7% | 83.8% | (many diffs) |
| 17 | mouse | 13052 | Cxadr | coxsackie virus and adenovi... | XM_017316864.1 | 52.9% | 55.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gctcctgctg tgcttcgtgc tcctgtgcgg agtagtggat ttcgccagaa 121 gtttgagtat cactactcct gaagagatga ttgaaaaagc caaaggggaa actgcctatc 181 tgccgtgcaa atttacgctt agtcccgaag accagggacc gctggacatc gagtggctga 241 tatcaccagc tgataatcag aaggtggatc aagtgattat tttatattct ggagacaaaa 301 tttatgatga ctactatcca gatctgaaag gccgagtaca ttttacgagt aatgatctca 361 aatctggtga tgcatcaata aatgtaacga atttacaact gtcagatatt ggcacatatc 421 agtgcaaagt gaaaaaagct cctggtgttg caaataagaa gattcatctg gtagttcttg 481 ttaagccttc aggtgcgaga tgttacgttg atggatctga agaaattgga agtgacttta 541 agataaaatg tgaaccaaaa gaaggttcac ttccattaca gtatgagtgg caaaaattgt 601 ctgactcaca gaaaatgccc acttcatggt tagcagaaat gacttcatct gttatatctg 661 taaaaaatgc cTCTTCTGAG TACTCTGGGA CATACAGCTG TACAGTCAGA AACAGAGTGG 721 GCTCTGATCA GTGCCTGTTG CGTCTAAACG TTGTCCCTCC TTCAAATAAA GCTGGACTAA 781 TTGCAGGAGC CATTATAGGA ACTTTGCTTG CTCTAGCGCT CATTGGTCTT ATCATCTTTT 841 GCTGTCGTAA AAAGCGCAGA GAAGAAAAAT ATGAAAAGGA AGTTCATCAC GATATCAGGG 901 AAGATGTGCC ACCTCCAAAG AGCCGTACGT CCACTGCCAG AAGCTACATC GGCAGTAATC 961 ATTCATCCCT GGGGTCCATG TCTCCTTCCA ACATGGAAGG ATATTCCAAG ACTCAGTATA 1021 ACCAAGTACC AAGTGAAGAC TTTGAACGCA CTCCTCAGAG TCCGACTCTC CCACCTGCTA 1081 AGGTAGCTGC CCCTAATCTA AGTCGAATGG GTGCGATTCC TGTGATGATT CCAGCACAGA 1141 GCAAGGATGG GTCTATAGTA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACATC CCCTGTGGTC 1321 TGTCATTTTC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt