Transcript: Human XM_011529476.2

PREDICTED: Homo sapiens CXADR Ig-like cell adhesion molecule (CXADR), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CXADR (1525)
Length:
1289
CDS:
115..1161

Additional Resources:

NCBI RefSeq record:
XM_011529476.2
NBCI Gene record:
CXADR (1525)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011529476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000281755 AGAAGCTACATCGGCAGTAAT pLKO_005 988 CDS 100% 13.200 7.920 N CXADR n/a
2 TRCN0000281754 TCAGTGCCTGTTGCGTCTAAA pLKO_005 777 CDS 100% 13.200 7.920 N CXADR n/a
3 TRCN0000281810 TTACGAGTAATGATCTCAAAT pLKO_005 392 CDS 100% 13.200 7.920 N CXADR n/a
4 TRCN0000061056 CCAAGTACCAAGTGAAGACTT pLKO.1 1071 CDS 100% 4.950 2.970 N CXADR n/a
5 TRCN0000061057 CGAGATGTTACGTTGATGGAT pLKO.1 545 CDS 100% 3.000 1.800 N CXADR n/a
6 TRCN0000061054 CCAGAAGTTTGAGTATCACTA pLKO.1 164 CDS 100% 4.950 2.475 Y CXADR n/a
7 TRCN0000061055 CCCACTTCATGGTTAGCAGAA pLKO.1 667 CDS 100% 4.050 2.025 Y CXADR n/a
8 TRCN0000061053 CCTTCAAATAAAGCTGGACTA pLKO.1 808 CDS 100% 4.050 2.025 Y CXADR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011529476.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06068 pDONR223 100% 93.4% 92.8% None (many diffs) n/a
2 ccsbBroad304_06068 pLX_304 0% 93.4% 92.8% V5 (many diffs) n/a
3 TRCN0000469000 CATCCCCTGTGGTCTGTCATTTTC pLX_317 44.8% 93.4% 92.8% V5 (many diffs) n/a
Download CSV