Construct: ORF TRCN0000469070
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF017088.1_s317c1
- Derived from:
- ccsbBroadEn_11052
- DNA Barcode:
- CTGTTAGTATTCACGCGCCCCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PPP2R5C (5527)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469070
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_178587.3 | 85.5% | 85.5% | 1153_1347del |
2 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_017021423.2 | 80.1% | 80.1% | 1153_1437del |
3 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001352912.1 | 79.1% | 79.1% | 1153_1455del |
4 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_178586.3 | 79.1% | 79.1% | 1153_1455del |
5 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_002719.4 | 73.2% | 73.2% | 1153_1572del |
6 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_005267824.1 | 68.6% | 66.1% | (many diffs) |
7 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001161726.2 | 68.5% | 66% | (many diffs) |
8 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_005267826.1 | 68.4% | 67.5% | (many diffs) |
9 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_011536918.1 | 68.3% | 66.9% | (many diffs) |
10 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001352914.2 | 67.9% | 65.4% | (many diffs) |
11 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_005267822.3 | 66.6% | 64.1% | (many diffs) |
12 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001161725.1 | 65.9% | 65.5% | (many diffs) |
13 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001352913.2 | 63.9% | 61.6% | (many diffs) |
14 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001352916.2 | 63.7% | 63.7% | 0_1ins225;928_1230del |
15 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_005267819.1 | 63.4% | 61.1% | (many diffs) |
16 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | NM_001352915.1 | 58.9% | 58.9% | 0_1ins225;928_1347del |
17 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_005267827.1 | 58.9% | 58.9% | 0_1ins225;928_1347del |
18 | human | 5527 | PPP2R5C | protein phosphatase 2 regul... | XM_011536920.1 | 58.9% | 58.9% | 0_1ins225;928_1347del |
19 | human | 5528 | PPP2R5D | protein phosphatase 2 regul... | NM_001270476.2 | 44.4% | 53.4% | (many diffs) |
20 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | NM_001081458.2 | 77.5% | 84% | (many diffs) |
21 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_017315084.1 | 76.6% | 83.1% | (many diffs) |
22 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | NM_001081457.2 | 72.2% | 78.3% | (many diffs) |
23 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_017315082.1 | 70.6% | 76.6% | (many diffs) |
24 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_017315081.1 | 67.6% | 73.3% | (many diffs) |
25 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | NM_001135001.1 | 66.9% | 71.1% | (many diffs) |
26 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | NM_012023.3 | 66.8% | 72.5% | (many diffs) |
27 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515923.3 | 66.2% | 70.4% | (many diffs) |
28 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515920.1 | 63.8% | 69.2% | (many diffs) |
29 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515922.2 | 62.8% | 66.7% | (many diffs) |
30 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515919.2 | 61.6% | 65.4% | (many diffs) |
31 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_017315086.1 | 61.3% | 66.5% | (many diffs) |
32 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_017315085.1 | 59.9% | 65.1% | (many diffs) |
33 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515918.2 | 59.2% | 62.9% | (many diffs) |
34 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515917.1 | 58.6% | 62.3% | (many diffs) |
35 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515924.2 | 56.2% | 59.7% | (many diffs) |
36 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_017315083.1 | 54.1% | 58.8% | (many diffs) |
37 | mouse | 26931 | Ppp2r5c | protein phosphatase 2, regu... | XM_006515921.1 | 47.5% | 50.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1218
- ORF length:
- 1152
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt gacatgtaat aaagcgggca gcaggatggt ggtggatgcg gccaactcca 121 atgggccttt ccagcccgtg gtccttctcc atattcgaga tgttcctcct gctgatcaag 181 agaagctttt tatccagaag ttacgtcagt gttgcgtcct ctttgacttt gtttctgatc 241 cactaagtga cctaaagtgg aaggaagtaa aacgagctgc tttaagtgaa atggtagaat 301 atatcaccca taatcggaat gtgatcacag agcctattta cccagaagta gtccatatgt 361 ttgcagttaa catgtttcga acattaccac cttcctccaa tcctacggga gcggaatttg 421 acccggagga agatgaacca acgttagaag cagcctggcc tcatctacag cttgtttatg 481 aatttttctt aagattttta gagtctccag atttccaacc taatatagcg aagaaatata 541 ttgatcagaa gtttgtattg cagcttttag agctctttga cagtgaagat cctcgggaga 601 gagattttct taaaaccacc cttcacagaa tctatgggaa attcctaggc ttgagagctt 661 acatcagaaa acagataaat aatatatttt ataggtttat ttatgaaaca gagcatcata 721 atggcatagc agagttactG GAAATATTGG GAAGTATAAT TAATGGATTT GCCTTACCAC 781 TAAAAGAAGA GCACAAGATT TTCTTATTGA AGGTGTTACT ACCTTTGCAC AAAGTGAAAT 841 CTCTGAGTGT CTACCATCCC CAGCTGGCAT ACTGTGTAGT GCAGTTTTTA GAAAAGGACA 901 GCACCCTCAC GGAACCAGTG GTGATGGCAC TTCTCAAATA CTGGCCAAAG ACTCACAGTC 961 CAAAAGAAGT AATGTTCTTA AACGAATTAG AAGAGATTTT AGATGTCATT GAACCATCAG 1021 AATTTGTGAA GATCATGGAA CCCCTCTTCC GGCAGTTGGC CAAATGTGTC TCCAGCCCAC 1081 ACTTCCAGGT GGCAGAGCGA GCTCTCTATT ACTGGAATAA TGAATACATC ATGAGTTTAA 1141 TCAGTGACAA CGCAGCGAAG ATTCTGCCCA TCATGTTTCC TTCCTTGTAC CGCAACTCAA 1201 AGACCCATTG GAACAAGTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1261 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1321 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACTGTTAG TATTCACGCG 1381 CCCCCTCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt