Transcript: Mouse NM_001135001.1

Mus musculus protein phosphatase 2, regulatory subunit B', gamma (Ppp2r5c), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ppp2r5c (26931)
Length:
2608
CDS:
181..1710

Additional Resources:

NCBI RefSeq record:
NM_001135001.1
NBCI Gene record:
Ppp2r5c (26931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001135001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080549 CGTCCTTATACCGCAACTCAA pLKO.1 1466 CDS 100% 4.950 6.930 N Ppp2r5c n/a
2 TRCN0000351428 CGTCCTTATACCGCAACTCAA pLKO_005 1466 CDS 100% 4.950 6.930 N Ppp2r5c n/a
3 TRCN0000080551 GCGAGAAGAAGCATGGGTTAA pLKO.1 1626 CDS 100% 10.800 8.640 N Ppp2r5c n/a
4 TRCN0000351674 GCGAGAAGAAGCATGGGTTAA pLKO_005 1626 CDS 100% 10.800 8.640 N Ppp2r5c n/a
5 TRCN0000080550 CATGAGTTTAATCAGTGACAA pLKO.1 1416 CDS 100% 4.950 3.465 N Ppp2r5c n/a
6 TRCN0000351426 CATGAGTTTAATCAGTGACAA pLKO_005 1416 CDS 100% 4.950 3.465 N Ppp2r5c n/a
7 TRCN0000080548 GCACAGAATCTATGGGAAGTT pLKO.1 909 CDS 100% 4.950 3.465 N Ppp2r5c n/a
8 TRCN0000323466 GCACAGAATCTATGGGAAGTT pLKO_005 909 CDS 100% 4.950 3.465 N Ppp2r5c n/a
9 TRCN0000080552 CTTGATATACAACGCCCTGAA pLKO.1 1515 CDS 100% 4.050 2.835 N Ppp2r5c n/a
10 TRCN0000334536 CTTGATATACAACGCCCTGAA pLKO_005 1515 CDS 100% 4.050 2.835 N Ppp2r5c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001135001.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11052 pDONR223 100% 66.9% 71.1% None (many diffs) n/a
2 ccsbBroad304_11052 pLX_304 57% 66.9% 71.1% V5 (many diffs) n/a
3 TRCN0000469070 CTGTTAGTATTCACGCGCCCCCTC pLX_317 41.7% 66.9% 71.1% V5 (many diffs) n/a
Download CSV