Transcript: Human NM_001352914.2

Homo sapiens protein phosphatase 2 regulatory subunit B'gamma (PPP2R5C), transcript variant 9, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
PPP2R5C (5527)
Length:
4455
CDS:
113..1750

Additional Resources:

NCBI RefSeq record:
NM_001352914.2
NBCI Gene record:
PPP2R5C (5527)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001352914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002497 CGGTCTTCACATGCTGCTATA pLKO.1 2890 3UTR 100% 10.800 15.120 N PPP2R5C n/a
2 TRCN0000002494 CCAGAAGTAGTCCATATGTTT pLKO.1 569 CDS 100% 0.000 0.000 N PPP2R5C n/a
3 TRCN0000293412 CCAGAAGTAGTCCATATGTTT pLKO_005 569 CDS 100% 0.000 0.000 N PPP2R5C n/a
4 TRCN0000293424 TGTGATCACAGAGCCTATTTA pLKO_005 547 CDS 100% 15.000 10.500 N PPP2R5C n/a
5 TRCN0000293484 CAAATCAAAGGAACGCTTTAA pLKO_005 2124 3UTR 100% 13.200 9.240 N PPP2R5C n/a
6 TRCN0000382166 CAGATTTCCAACCTAATATAG pLKO_005 735 CDS 100% 13.200 9.240 N PPP2R5C n/a
7 TRCN0000002498 CGGGAAGAAGCATGGGTTAAA pLKO.1 1568 CDS 100% 13.200 9.240 N PPP2R5C n/a
8 TRCN0000293413 CGGGAAGAAGCATGGGTTAAA pLKO_005 1568 CDS 100% 13.200 9.240 N PPP2R5C n/a
9 TRCN0000080550 CATGAGTTTAATCAGTGACAA pLKO.1 1357 CDS 100% 4.950 3.465 N Ppp2r5c n/a
10 TRCN0000351426 CATGAGTTTAATCAGTGACAA pLKO_005 1357 CDS 100% 4.950 3.465 N Ppp2r5c n/a
11 TRCN0000002496 TCCAGAAGTTACGTCAGTGTT pLKO.1 420 CDS 100% 4.950 3.465 N PPP2R5C n/a
12 TRCN0000293411 TCCAGAAGTTACGTCAGTGTT pLKO_005 420 CDS 100% 4.950 3.465 N PPP2R5C n/a
13 TRCN0000080552 CTTGATATACAACGCCCTGAA pLKO.1 1456 CDS 100% 4.050 2.835 N Ppp2r5c n/a
14 TRCN0000334536 CTTGATATACAACGCCCTGAA pLKO_005 1456 CDS 100% 4.050 2.835 N Ppp2r5c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001352914.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11052 pDONR223 100% 67.9% 65.4% None (many diffs) n/a
2 ccsbBroad304_11052 pLX_304 57% 67.9% 65.4% V5 (many diffs) n/a
3 TRCN0000469070 CTGTTAGTATTCACGCGCCCCCTC pLX_317 41.7% 67.9% 65.4% V5 (many diffs) n/a
Download CSV