Construct: ORF TRCN0000469107
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008373.1_s317c1
- Derived from:
- ccsbBroadEn_11267
- DNA Barcode:
- ATTTGGTTCAGATACTGGTGTTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- H2BC15 (8341)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469107
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8341 | H2BC15 | H2B clustered histone 15 | NM_003520.3 | 75.9% | 75.9% | 378_379ins120 |
2 | human | 440689 | H2BC18 | H2B clustered histone 18 | NM_001161334.1 | 72.4% | 71.6% | (many diffs) |
3 | human | 8340 | H2BC13 | H2B clustered histone 13 | NM_003519.3 | 71.4% | 74% | (many diffs) |
4 | human | 8344 | H2BC6 | H2B clustered histone 6 | NM_003523.2 | 70.6% | 75.3% | (many diffs) |
5 | human | 3017 | H2BC5 | H2B clustered histone 5 | NM_021063.3 | 70.6% | 75.3% | (many diffs) |
6 | human | 3017 | H2BC5 | H2B clustered histone 5 | NM_138720.2 | 70.6% | 75.3% | (many diffs) |
7 | human | 8346 | H2BC10 | H2B clustered histone 10 | NM_003525.2 | 69.8% | 75.3% | (many diffs) |
8 | human | 85236 | H2BC12 | H2B clustered histone 12 | NM_001312653.1 | 69.8% | 74.6% | (many diffs) |
9 | human | 85236 | H2BC12 | H2B clustered histone 12 | NM_080593.2 | 69.8% | 74.6% | (many diffs) |
10 | human | 8348 | H2BC17 | H2B clustered histone 17 | NM_003527.4 | 69.8% | 74% | (many diffs) |
11 | human | 8343 | H2BC7 | H2B clustered histone 7 | NM_003522.3 | 69.6% | 75.3% | (many diffs) |
12 | human | 8347 | H2BC4 | H2B clustered histone 4 | NM_003526.2 | 69.6% | 75.3% | (many diffs) |
13 | human | 54145 | H2BS1 | H2B.S histone 1 | NM_017445.3 | 69.6% | 73.4% | (many diffs) |
14 | human | 102724334 | LOC102724334 | histone H2B type F-S-like | XM_006723918.4 | 69.6% | 73.4% | (many diffs) |
15 | human | 8349 | H2BC21 | H2B clustered histone 21 | NM_003528.2 | 69.2% | 74.6% | (many diffs) |
16 | human | 8345 | H2BC9 | H2B clustered histone 9 | NM_003524.2 | 69% | 74.6% | (many diffs) |
17 | human | 440689 | H2BC18 | H2B clustered histone 18 | NM_001024599.4 | 69% | 74% | (many diffs) |
18 | human | 337875 | H2BP1 | H2B histone pseudogene 1 | NR_160944.2 | 69% | (many diffs) | |
19 | human | 8970 | H2BC11 | H2B clustered histone 11 | NM_021058.3 | 68.4% | 74% | (many diffs) |
20 | human | 128312 | H2BU1 | H2B.U histone 1 | NM_175055.2 | 67.6% | 72.8% | (many diffs) |
21 | human | 8342 | H2BC14 | H2B clustered histone 14 | NM_003521.2 | 67.6% | 73.4% | (many diffs) |
22 | human | 8339 | H2BC8 | H2B clustered histone 8 | NM_003518.3 | 66.8% | 75.3% | (many diffs) |
23 | human | 3018 | H2BC3 | H2B clustered histone 3 | NM_021062.2 | 66.2% | 74.6% | (many diffs) |
24 | human | 337873 | H2BC20P | H2B clustered histone 20, p... | NR_036461.1 | 65.1% | (many diffs) | |
25 | human | 3017 | H2BC5 | H2B clustered histone 5 | XM_005249039.4 | 61.7% | 65.7% | (many diffs) |
26 | human | 338391 | H2BP2 | H2B histone pseudogene 2 | NR_160915.1 | 24.8% | (many diffs) | |
27 | mouse | 319188 | Hist1h2bp | histone cluster 1, H2bp | NM_178202.2 | 73.1% | 74.4% | (many diffs) |
28 | mouse | 665596 | Hist1h2bq | histone cluster 1, H2bq | NM_001097979.2 | 72.9% | 74.6% | (many diffs) |
29 | mouse | 665622 | Hist1h2br | histone cluster 1 H2br | NM_001110555.1 | 72.9% | 74.6% | (many diffs) |
30 | mouse | 68024 | Hist1h2bc | histone cluster 1, H2bc | NM_001290380.1 | 71.4% | 75.3% | (many diffs) |
31 | mouse | 68024 | Hist1h2bc | histone cluster 1, H2bc | NM_023422.3 | 71.4% | 75.3% | (many diffs) |
32 | mouse | 319181 | Hist1h2bg | histone cluster 1, H2bg | NM_178196.4 | 71.2% | 75.3% | (many diffs) |
33 | mouse | 319185 | Hist1h2bl | histone cluster 1, H2bl | NM_178199.2 | 71.2% | 74.6% | (many diffs) |
34 | mouse | 319179 | Hist1h2be | histone cluster 1, H2be | NM_001177653.1 | 71% | 75.3% | (many diffs) |
35 | mouse | 319179 | Hist1h2be | histone cluster 1, H2be | NM_001290530.1 | 71% | 75.3% | (many diffs) |
36 | mouse | 319179 | Hist1h2be | histone cluster 1, H2be | NM_178194.4 | 71% | 75.3% | (many diffs) |
37 | mouse | 665622 | Hist1h2br | histone cluster 1 H2br | NM_001313878.1 | 71% | 74.6% | (many diffs) |
38 | mouse | 665596 | Hist1h2bq | histone cluster 1, H2bq | NM_001313880.1 | 71% | 74.6% | (many diffs) |
39 | mouse | 319182 | Hist1h2bh | histone cluster 1, H2bh | NM_178197.2 | 71% | 74.6% | (many diffs) |
40 | mouse | 319183 | Hist1h2bj | histone cluster 1, H2bj | NM_178198.2 | 71% | 74.6% | (many diffs) |
41 | mouse | 319186 | Hist1h2bm | histone cluster 1, H2bm | NM_178200.2 | 70.8% | 75.3% | (many diffs) |
42 | mouse | 319180 | Hist1h2bf | histone cluster 1, H2bf | NM_178195.2 | 70.8% | 74.6% | (many diffs) |
43 | mouse | 319187 | Hist1h2bn | histone cluster 1, H2bn | NM_178201.2 | 70.4% | 74.6% | (many diffs) |
44 | mouse | 319188 | Hist1h2bp | histone cluster 1, H2bp | NM_001290466.1 | 70% | 74% | (many diffs) |
45 | mouse | 319184 | Hist1h2bk | histone cluster 1, H2bk | NM_175665.2 | 70% | 74% | (many diffs) |
46 | mouse | 319188 | Hist1h2bp | histone cluster 1, H2bp | XM_006516690.2 | 70% | 74% | (many diffs) |
47 | mouse | 319178 | Hist1h2bb | histone cluster 1, H2bb | NM_175664.3 | 68.6% | 74% | (many diffs) |
48 | mouse | 78303 | Hist3h2ba | histone cluster 3, H2ba | NM_030082.4 | 67.6% | 71.6% | (many diffs) |
49 | mouse | 319189 | Hist2h2bb | histone cluster 2, H2bb | NM_175666.2 | 65.8% | 74% | (many diffs) |
50 | mouse | 319177 | Hist1h2ba | histone cluster 1, H2ba | NM_175663.2 | 65.3% | 65.8% | (many diffs) |
51 | mouse | 319190 | Hist2h2be | histone cluster 2, H2be | NM_178214.4 | 65.1% | 72.2% | (many diffs) |
52 | mouse | 382522 | Hist3h2bb-ps | histone cluster 3, H2bb, ps... | NR_134309.1 | 58% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 564
- ORF length:
- 498
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc cgagccctca aagtccgctc ctgccccgaa gaaaggctcc aagaaggcag 121 tgacaaaggc ccagaagaag gacggcaaga agcgcaagcg cagccgcaag gagagctact 181 ccgtgtacgt gtacaaggtg ctgaagcagg tccaccccga caccggtatc tcgtccaagg 241 ccatgggcat catgaactcc ttcgtcaatg acatcttcga gcgcatcgcc ggcgaggctt 301 cccgcctggc gcattacaac aagcgctcga ccatcacctc cagggagatc cagacggccg 361 tgcgcctgct gctgccaggg gagctggcca agcacgcggt gtcggagggc accaaggccg 421 tcaccaagta caccagttcc aagaagagaa aaagaagatt cacagagagc attaagaaGG 481 CCCATGGATT CAGAAAGCTC AAGATTTGGC TAAAATTAAG AGTCAGCAAC CAATCTCCAG 541 ATGACATTTA TATTGCACGA GATTGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 601 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 661 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TTTGGTTCAG 721 ATACTGGTGT TTTACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 781 att