Transcript: Human NM_021058.3

Homo sapiens H2B clustered histone 11 (H2BC11), mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H2BC11 (8970)
Length:
481
CDS:
47..427

Additional Resources:

NCBI RefSeq record:
NM_021058.3
NBCI Gene record:
H2BC11 (8970)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_021058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000106767 ATTCGTTTGTGAACGACATTT pLKO.1 237 CDS 100% 1.320 0.924 N H2BC11 n/a
2 TRCN0000106768 GAGCTATTCCATCTATGTGTA pLKO.1 154 CDS 100% 4.950 2.970 N H2BC11 n/a
3 TRCN0000106766 GCAGAAGAAAGACGGCAAGAA pLKO.1 112 CDS 100% 4.950 2.970 N H2BC11 n/a
4 TRCN0000106769 CGGCATTTCGTCCAAGGCCAT pLKO.1 205 CDS 100% 0.720 0.432 N H2BC11 n/a
5 TRCN0000106765 CATCATGAATTCGTTTGTGAA pLKO.1 229 CDS 100% 0.000 0.000 N H2BC11 n/a
6 TRCN0000096962 CAAGGCCATGGGCATCATGAA pLKO.1 217 CDS 100% 4.950 2.475 Y Hist1h2bn n/a
7 TRCN0000435792 ACAACAAGCGCTCGACCATCA pLKO_005 297 CDS 100% 4.050 2.025 Y Hist1h2bk n/a
8 TRCN0000445772 ACAACAAGCGCTCGACCATCA pLKO_005 297 CDS 100% 4.050 2.025 Y H2BC4 n/a
9 TRCN0000262206 TACAACAAGCGCTCGACCATC pLKO_005 296 CDS 100% 4.050 2.025 Y Hist1h2br n/a
10 TRCN0000437414 TACAACAAGCGCTCGACCATC pLKO_005 296 CDS 100% 4.050 2.025 Y H2BC15 n/a
11 TRCN0000379264 CAGCCGCAAGGAGAGCTATTC pLKO_005 142 CDS 100% 3.600 1.800 Y Hist1h2bb n/a
12 TRCN0000437950 TTACAACAAGCGCTCGACCAT pLKO_005 295 CDS 100% 2.640 1.320 Y Hist1h2bg n/a
13 TRCN0000421762 CCGCCTGGCGCATTACAACAA pLKO_005 283 CDS 100% 1.650 0.825 Y Hist1h2bk n/a
14 TRCN0000106961 GACCATCACCTCCAGGGAGAT pLKO.1 310 CDS 100% 1.350 0.675 Y H2BC13 n/a
15 TRCN0000096960 GAAGCGCAAGCGCAGCCGCAA pLKO.1 130 CDS 100% 0.000 0.000 Y Hist1h2bn n/a
16 TRCN0000096963 GCGCAGCCGCAAGGAGAGCTA pLKO.1 139 CDS 100% 0.000 0.000 Y Hist1h2bn n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021058.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15861 pDONR223 0% 92.3% 98.4% None (many diffs) n/a
2 ccsbBroad304_15861 pLX_304 0% 92.3% 98.4% V5 (many diffs) n/a
3 TRCN0000466058 TATAACTAACAAACAAGCTAACTT pLX_317 98.5% 92.3% 98.4% V5 (many diffs) n/a
4 ccsbBroadEn_12031 pDONR223 100% 92% 97.6% None (many diffs) n/a
5 ccsbBroad304_12031 pLX_304 0% 92% 97.6% V5 (many diffs) n/a
6 TRCN0000469135 AACATACCTTGTTGTCATTTATTA pLX_317 100% 92% 97.6% V5 (many diffs) n/a
7 ccsbBroadEn_04472 pDONR223 100% 92% 99.2% None (many diffs) n/a
8 ccsbBroad304_04472 pLX_304 0% 92% 99.2% V5 (many diffs) n/a
9 TRCN0000471184 TCCCCACAGAAAAAGCTTCGCGAC pLX_317 82.9% 92% 99.2% V5 (many diffs) n/a
10 ccsbBroadEn_06348 pDONR223 100% 90.7% 98.4% None (many diffs) n/a
11 ccsbBroad304_06348 pLX_304 0% 90.7% 98.4% V5 (many diffs) n/a
12 TRCN0000466554 GCTTTTTGTCTTCCCTACTCACGT pLX_317 98.5% 90.7% 98.4% V5 (many diffs) n/a
13 ccsbBroadEn_01898 pDONR223 100% 90.2% 97.6% None (many diffs) n/a
14 ccsbBroad304_01898 pLX_304 0% 90.2% 97.6% V5 (many diffs) n/a
15 TRCN0000469156 CCCGCACAGGGATTAGCAAAGTTG pLX_317 89.9% 90.2% 97.6% V5 (many diffs) n/a
16 ccsbBroadEn_07223 pDONR223 100% 90.2% 97.6% None (many diffs) n/a
17 ccsbBroad304_07223 pLX_304 0% 90.2% 97.6% V5 (many diffs) n/a
18 TRCN0000471318 CGGCGACCCACTCTTCACCGCCCG pLX_317 96.2% 90.2% 97.6% V5 (many diffs) n/a
19 ccsbBroadEn_01901 pDONR223 100% 90.2% 97.6% None (many diffs) n/a
20 ccsbBroad304_01901 pLX_304 0% 90.2% 97.6% V5 (many diffs) n/a
21 TRCN0000468700 CGACGATGACTCTCCCTCATTTGA pLX_317 100% 90.2% 97.6% V5 (many diffs) n/a
22 ccsbBroadEn_07224 pDONR223 100% 89.6% 99.2% None (many diffs) n/a
23 ccsbBroad304_07224 pLX_304 0% 89.6% 99.2% V5 (many diffs) n/a
24 TRCN0000472239 ATGAGCATATTTAAATGCTTTCTC pLX_317 100% 89.6% 99.2% V5 (many diffs) n/a
25 ccsbBroadEn_01900 pDONR223 100% 89.6% 98.4% None (many diffs) n/a
26 ccsbBroad304_01900 pLX_304 0% 89.6% 98.4% V5 (many diffs) n/a
27 TRCN0000470158 AGTTTACTCTTCCCTTTATTAGAT pLX_317 90.5% 89.6% 98.4% V5 (many diffs) n/a
28 ccsbBroadEn_01902 pDONR223 100% 89.4% 98.4% None (many diffs) n/a
29 ccsbBroad304_01902 pLX_304 0% 89.4% 98.4% V5 (many diffs) n/a
30 TRCN0000473896 CTGGCTTAAGACAGAATAAACCCC pLX_317 100% 89.4% 98.4% V5 (many diffs) n/a
31 ccsbBroadEn_01903 pDONR223 100% 89.4% 99.2% None (many diffs) n/a
32 ccsbBroad304_01903 pLX_304 0% 89.4% 99.2% V5 (many diffs) n/a
33 TRCN0000474598 ACTACAGCTCACCGGCGTAGGAAC pLX_317 100% 89.4% 99.2% V5 (many diffs) n/a
34 ccsbBroadEn_05671 pDONR223 100% 88.6% 96.8% None (many diffs) n/a
35 ccsbBroad304_05671 pLX_304 0% 88.6% 96.8% V5 (many diffs) n/a
36 TRCN0000476574 TAAAAAAACATGTTATCTATAAGA pLX_317 92.5% 88.6% 96.8% V5 (many diffs) n/a
37 ccsbBroadEn_01897 pDONR223 100% 86.7% 98.4% None (many diffs) n/a
38 ccsbBroad304_01897 pLX_304 0% 86.7% 98.4% V5 (many diffs) n/a
39 TRCN0000471861 TGCACGGGACGCACCAAATGACCA pLX_317 90.4% 86.7% 98.4% V5 (many diffs) n/a
40 ccsbBroadEn_01899 pDONR223 100% 86.2% 95.2% None (many diffs) n/a
41 ccsbBroad304_01899 pLX_304 0% 86.2% 95.2% V5 (many diffs) n/a
42 TRCN0000477535 GAGTATGATTCTCGACACACTATA pLX_317 98.5% 86.2% 95.2% V5 (many diffs) n/a
43 ccsbBroadEn_04839 pDONR223 100% 85.9% 95.2% None (many diffs) n/a
44 ccsbBroad304_04839 pLX_304 0% 85.9% 95.2% V5 (many diffs) n/a
45 TRCN0000466986 TCACGGGATGAGCTCCAAAAATGA pLX_317 100% 85.9% 95.2% V5 (many diffs) n/a
46 ccsbBroadEn_11267 pDONR223 100% 68.4% 74% None (many diffs) n/a
47 ccsbBroad304_11267 pLX_304 0% 68.4% 74% V5 (many diffs) n/a
48 TRCN0000469107 ATTTGGTTCAGATACTGGTGTTTT pLX_317 18.5% 68.4% 74% V5 (many diffs) n/a
49 ccsbBroadEn_11322 pDONR223 100% 61.6% 60.3% None 227_230delGTGA;235T>A;239_378del n/a
50 ccsbBroad304_11322 pLX_304 0% 61.6% 60.3% V5 227_230delGTGA;235T>A;239_378del n/a
51 TRCN0000471205 GAGTACAAGAAACTGCTGAAATGG pLX_317 100% 61.6% 60.3% V5 227_230delGTGA;235T>A;239_378del n/a
52 ccsbBroadEn_10354 pDONR223 100% 46.6% 50.7% None (many diffs) n/a
53 ccsbBroad304_10354 pLX_304 0% 46.6% 50.7% V5 (many diffs) n/a
54 TRCN0000466355 TTCTAACCCCTTTGTAGACCAATG pLX_317 100% 46.6% 50.7% V5 (many diffs) n/a
Download CSV