Construct: ORF TRCN0000469303
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001075.1_s317c1
- Derived from:
- ccsbBroadEn_01830
- DNA Barcode:
- TCTCAGCTTTCATATGACGGCCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DAP3 (7818)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469303
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7818 | DAP3 | death associated protein 3 | NM_001199849.1 | 100% | 100% | |
| 2 | human | 7818 | DAP3 | death associated protein 3 | NM_004632.4 | 100% | 100% | |
| 3 | human | 7818 | DAP3 | death associated protein 3 | NM_033657.2 | 100% | 100% | |
| 4 | human | 7818 | DAP3 | death associated protein 3 | XM_024449697.1 | 100% | 100% | |
| 5 | human | 7818 | DAP3 | death associated protein 3 | XM_017002289.1 | 93.2% | 93.2% | 600_601ins81 |
| 6 | human | 7818 | DAP3 | death associated protein 3 | XM_017002290.1 | 93.2% | 93.2% | 600_601ins81 |
| 7 | human | 7818 | DAP3 | death associated protein 3 | XM_024449698.1 | 93.2% | 93.2% | 600_601ins81 |
| 8 | human | 7818 | DAP3 | death associated protein 3 | NM_001199850.1 | 91.4% | 91.4% | 167_168ins102 |
| 9 | human | 7818 | DAP3 | death associated protein 3 | XM_005245480.2 | 91.4% | 91.4% | 167_168ins102 |
| 10 | human | 7818 | DAP3 | death associated protein 3 | XM_017002291.1 | 91.4% | 91.4% | 167_168ins102 |
| 11 | human | 7818 | DAP3 | death associated protein 3 | NM_001199851.1 | 89.6% | 89.6% | 44_45ins123 |
| 12 | human | 7818 | DAP3 | death associated protein 3 | XM_005245481.2 | 89.6% | 89.6% | 44_45ins123 |
| 13 | human | 7818 | DAP3 | death associated protein 3 | XM_017002292.1 | 89.6% | 89.6% | 44_45ins123 |
| 14 | human | 7818 | DAP3 | death associated protein 3 | XM_017002293.1 | 89.6% | 89.6% | 44_45ins123 |
| 15 | human | 7818 | DAP3 | death associated protein 3 | XM_017002294.1 | 84.6% | 84.6% | 167_168ins102;498_499ins81 |
| 16 | human | 7818 | DAP3 | death associated protein 3 | XM_017002295.1 | 82.9% | 82.9% | 44_45ins123;477_478ins81 |
| 17 | human | 7818 | DAP3 | death associated protein 3 | XM_024449700.1 | 82.9% | 82.9% | 44_45ins123;477_478ins81 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1263
- ORF length:
- 1194
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gatgctgaaa ggaataacaa ggcttatctc taggatccat aagttggacc 121 ctgggcgttt tttacacatg gggacccagg ctcgccaaag cattgctgct cacctagata 181 accaggttcc agttgagagt ccgagagcta tttcccgcac caatgagaat gacccggcca 241 agcatgggga tcagcacgag ggtcagcact acaacatctc cccccaggat ttggagactg 301 tatttcccca tggccttcct cctcgctttg tgatgcaggt gaagacattc agtgaagctt 361 gcctgatggt aaggaaacca gccctagaac ttctgcatta cctgaaaaac accagttttg 421 cttatccagc tatacgatat cttctgtatg gagagaaggg aacaggaaaa accctaagtc 481 tttgccatgt tattcatttc tgtgcaaaac aggactggct gatactacat attccagatg 541 ctcatctttg ggtgaaaaat tgtcgggatc ttctgcagtc cagctacaac aaacagcgct 601 ttgatcaacc tttagaggct tcaacctggc tgaagaattt caaaactaca aatgagcgct 661 tcctgaacca gataaaagtt caagagaagt atgtctggaa taagagagaa agcactgaga 721 aagggagtcc tctgggagaa gtggttgaac agggcataac acgggtgagg aacgccacag 781 atgcagttgg aattgtgctg aaagagctaa agaggcaaag ttctttgggt atgtttcacc 841 tcctagtggc cgtggatgga atcaatgctc tttgggGAAG AACCACTCTG AAAAGAGAAG 901 ATAAAAGCCC GATTGCCCCC GAGGAATTAG CACTTGTTCA CAACTTGAGG AAAATGATGA 961 AAAATGATTG GCATGGAGGC GCCATTGTGT CGGCTTTGAG CCAGACTGGG TCTCTCTTTA 1021 AGCCCCGGAA AGCCTATCTG CCCCAGGAGT TGCTGGGAAA GGAAGGATTT GATGCCCTGG 1081 ATCCCTTTAT TCCCATCCTG GTTTCCAACT ATAACCCAAA GGAATTTGAA AGTTGTATTC 1141 AGTATTATTT GGAAAACAAT TGGCTTCAAC ATGAGAAAGC TCCTACAGAA GAAGGGAAAA 1201 AAGAGCTGCT GTTCCTAAGT AACGCGAACC CCTCGCTGCT GGAGCGGCAC TGTGCCTACC 1261 TCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1321 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1381 GGCTTTATAT ATCTTGTGGA AAGGACGATC TCAGCTTTCA TATGACGGCC ACACGCGTTA 1441 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt