Transcript: Human XM_024449698.1

PREDICTED: Homo sapiens death associated protein 3 (DAP3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DAP3 (7818)
Length:
1781
CDS:
379..1494

Additional Resources:

NCBI RefSeq record:
XM_024449698.1
NBCI Gene record:
DAP3 (7818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229950 GCTTATCCAGCTATACGATAT pLKO_005 730 CDS 100% 10.800 15.120 N DAP3 n/a
2 TRCN0000117433 CCCGAGGAATTAGCACTTGTT pLKO.1 1147 CDS 100% 4.950 6.930 N DAP3 n/a
3 TRCN0000217999 ATCCTGGTTTCCAACTATAAC pLKO_005 1324 CDS 100% 13.200 9.240 N DAP3 n/a
4 TRCN0000117436 CATCCTGGTTTCCAACTATAA pLKO.1 1323 CDS 100% 13.200 9.240 N DAP3 n/a
5 TRCN0000229949 CATTGCTGCTCACCTAGATAA pLKO_005 471 CDS 100% 13.200 9.240 N DAP3 n/a
6 TRCN0000257104 TTGGCTCTGGACCTGCATTAA pLKO_005 1626 3UTR 100% 13.200 9.240 N DAP3 n/a
7 TRCN0000229951 CAGCGCTTTGATCAACCTTTA pLKO_005 904 CDS 100% 10.800 7.560 N DAP3 n/a
8 TRCN0000117435 GCTTGCCTGATGGTAAGGAAA pLKO.1 667 CDS 100% 4.950 3.465 N DAP3 n/a
9 TRCN0000117432 TCACTGTGAATGCGTGACAAT pLKO.1 1655 3UTR 100% 4.950 3.465 N DAP3 n/a
10 TRCN0000104459 CAGATGCTCATCTTTGGGTAA pLKO.1 845 CDS 100% 4.050 2.835 N Dap3 n/a
11 TRCN0000316404 CAGATGCTCATCTTTGGGTAA pLKO_005 845 CDS 100% 4.050 2.835 N Dap3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449698.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01830 pDONR223 100% 93.2% 93.2% None 600_601ins81 n/a
2 ccsbBroad304_01830 pLX_304 0% 93.2% 93.2% V5 600_601ins81 n/a
3 TRCN0000469303 TCTCAGCTTTCATATGACGGCCAC pLX_317 32.6% 93.2% 93.2% V5 600_601ins81 n/a
Download CSV