Transcript: Human NM_033657.2

Homo sapiens death associated protein 3 (DAP3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
DAP3 (7818)
Length:
2134
CDS:
158..1354

Additional Resources:

NCBI RefSeq record:
NM_033657.2
NBCI Gene record:
DAP3 (7818)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229950 GCTTATCCAGCTATACGATAT pLKO_005 509 CDS 100% 10.800 15.120 N DAP3 n/a
2 TRCN0000117433 CCCGAGGAATTAGCACTTGTT pLKO.1 1007 CDS 100% 4.950 6.930 N DAP3 n/a
3 TRCN0000217999 ATCCTGGTTTCCAACTATAAC pLKO_005 1184 CDS 100% 13.200 9.240 N DAP3 n/a
4 TRCN0000117436 CATCCTGGTTTCCAACTATAA pLKO.1 1183 CDS 100% 13.200 9.240 N DAP3 n/a
5 TRCN0000229949 CATTGCTGCTCACCTAGATAA pLKO_005 250 CDS 100% 13.200 9.240 N DAP3 n/a
6 TRCN0000257104 TTGGCTCTGGACCTGCATTAA pLKO_005 1486 3UTR 100% 13.200 9.240 N DAP3 n/a
7 TRCN0000229951 CAGCGCTTTGATCAACCTTTA pLKO_005 683 CDS 100% 10.800 7.560 N DAP3 n/a
8 TRCN0000117435 GCTTGCCTGATGGTAAGGAAA pLKO.1 446 CDS 100% 4.950 3.465 N DAP3 n/a
9 TRCN0000117432 TCACTGTGAATGCGTGACAAT pLKO.1 1515 3UTR 100% 4.950 3.465 N DAP3 n/a
10 TRCN0000104459 CAGATGCTCATCTTTGGGTAA pLKO.1 624 CDS 100% 4.050 2.835 N Dap3 n/a
11 TRCN0000316404 CAGATGCTCATCTTTGGGTAA pLKO_005 624 CDS 100% 4.050 2.835 N Dap3 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1822 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033657.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01830 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01830 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469303 TCTCAGCTTTCATATGACGGCCAC pLX_317 32.6% 100% 100% V5 n/a
Download CSV