Construct: ORF TRCN0000469330
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007710.1_s317c1
- Derived from:
- ccsbBroadEn_03675
- DNA Barcode:
- CACCGTTACAGGCTTTCGCACTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WSB2 (55884)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469330
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55884 | WSB2 | WD repeat and SOCS box cont... | NM_018639.4 | 100% | 100% | |
| 2 | human | 55884 | WSB2 | WD repeat and SOCS box cont... | NM_001278557.1 | 95.8% | 95.2% | (many diffs) |
| 3 | human | 55884 | WSB2 | WD repeat and SOCS box cont... | NM_001278558.1 | 48% | 48% | 0_1ins630 |
| 4 | human | 55884 | WSB2 | WD repeat and SOCS box cont... | XM_017019642.1 | 48% | 48% | 0_1ins630 |
| 5 | mouse | 59043 | Wsb2 | WD repeat and SOCS box-cont... | NM_021539.4 | 88.6% | 96.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1278
- ORF length:
- 1212
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga ggccggagag gaaccgctgc tgctggccga actcaagccc gggcgccccc 121 accagtttga ttggaagtcc agctgtgaaa cctggagcgt cgccttctcc ccagatggct 181 cctggtttgc ttggtctcaa ggacactgca tcgtcaaact gatcccctgg ccgttggagg 241 agcagttcat ccctaaaggg tttgaagcca aaagccgaag tagcaaaaat gagacgaaag 301 ggcggggcag cccaaaagag aagacgctgg actgtggtca gattgtctgg gggctggcct 361 tcagcccgtg gccttcccca cccagcagga agctctgggc acgccaccac ccccaagtgc 421 ccgatgtctc ttgcctggtt cttgctacgg gactcaacga tgggcagatc aagatctggg 481 aggtgcagac agggctcctg cttttgaatc tttccggcca ccaagatgtc gtgagagatc 541 tgagcttcac acccagtggc agtttgattt tggtctccgc gtcacgggat aagactcttc 601 gcatctggga cctgaataaa cacggtaaac agattcaagt gttatcgggc cacctgcagt 661 gggtttactg ctgttccatc tccccagact gcagcatgct gtgctctgca gctggagaga 721 agtcggtctt tctatggagc atgaggtcct acacgttaat tcggaagcta gagggccatc 781 aaagcagtgt tgtctcttgt gacttctccc ccgactctgc cctgcttGTC ACGGCTTCTT 841 ACGATACCAA TGTGATTATG TGGGACCCCT ACACCGGCGA AAGGCTGAGG TCACTCCACC 901 ACACCCAGGT TGACCCCGCC ATGGATGACA GTGACGTCCA CATTAGCTCA CTGAGATCTG 961 TGTGCTTCTC TCCAGAAGGC TTGTACCTTG CCACGGTGGC AGATGACAGA CTCCTCAGGA 1021 TCTGGGCCCT GGAACTGAAA ACTCCCATTG CATTTGCTCC TATGACCAAT GGGCTTTGCT 1081 GCACATTTTT TCCACATGGT GGAGTCATTG CCACAGGGAC AAGAGATGGC CACGTCCAGT 1141 TCTGGACAGC TCCTAGGGTC CTGTCCTCAC TGAAGCACTT ATGCCGGAAA GCCCTTCGAA 1201 GTTTCCTAAC AACTTACCAA GTCCTAGCAC TGCCAATCCC CAAGAAAATG AAAGAGTTCC 1261 TCACATACAG GACTTTTTAC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1321 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1381 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGACACCGTT ACAGGCTTTC 1441 GCACTCGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt