Transcript: Mouse NM_021539.4

Mus musculus WD repeat and SOCS box-containing 2 (Wsb2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Wsb2 (59043)
Length:
2438
CDS:
157..1371

Additional Resources:

NCBI RefSeq record:
NM_021539.4
NBCI Gene record:
Wsb2 (59043)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021539.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183079 CAAGCGAGTATTCAGATCATA pLKO.1 1868 3UTR 100% 5.625 7.875 N Wsb2 n/a
2 TRCN0000179655 GAGGAACAGTTCATCCCTAAA pLKO.1 328 CDS 100% 10.800 7.560 N Wsb2 n/a
3 TRCN0000184494 GCAGTGTTGTCTCCTGTGATT pLKO.1 875 CDS 100% 4.950 3.465 N Wsb2 n/a
4 TRCN0000195848 CAATGGTCTTTGCTGCACGTT pLKO.1 1158 CDS 100% 2.640 1.848 N Wsb2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021539.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03675 pDONR223 100% 88.6% 96.2% None (many diffs) n/a
2 ccsbBroad304_03675 pLX_304 0% 88.6% 96.2% V5 (many diffs) n/a
3 TRCN0000469330 CACCGTTACAGGCTTTCGCACTCG pLX_317 37.4% 88.6% 96.2% V5 (many diffs) n/a
Download CSV