Transcript: Human NM_001278557.1

Homo sapiens WD repeat and SOCS box containing 2 (WSB2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
WSB2 (55884)
Length:
2798
CDS:
13..1278

Additional Resources:

NCBI RefSeq record:
NM_001278557.1
NBCI Gene record:
WSB2 (55884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001278557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000072338 CCAGACACTATTACTGGCTTT pLKO.1 1892 3UTR 100% 4.050 5.670 N WSB2 n/a
2 TRCN0000289491 CCAGACACTATTACTGGCTTT pLKO_005 1892 3UTR 100% 4.050 5.670 N WSB2 n/a
3 TRCN0000072340 CCCTTCGAAGTTTCCTAACAA pLKO.1 1190 CDS 100% 5.625 3.938 N WSB2 n/a
4 TRCN0000289492 CCCTTCGAAGTTTCCTAACAA pLKO_005 1190 CDS 100% 5.625 3.938 N WSB2 n/a
5 TRCN0000072339 CGGTAAACAGATTCAAGTGTT pLKO.1 621 CDS 100% 4.950 3.465 N WSB2 n/a
6 TRCN0000289551 CGGTAAACAGATTCAAGTGTT pLKO_005 621 CDS 100% 4.950 3.465 N WSB2 n/a
7 TRCN0000072342 CCCACCAGTTTGATTGGAAGT pLKO.1 116 CDS 100% 4.050 2.835 N WSB2 n/a
8 TRCN0000289493 CCCACCAGTTTGATTGGAAGT pLKO_005 116 CDS 100% 4.050 2.835 N WSB2 n/a
9 TRCN0000072341 CACGGCTTCTTACGATACCAA pLKO.1 828 CDS 100% 3.000 2.100 N WSB2 n/a
10 TRCN0000307065 CACGGCTTCTTACGATACCAA pLKO_005 828 CDS 100% 3.000 2.100 N WSB2 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2652 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001278557.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03675 pDONR223 100% 95.8% 95.2% None (many diffs) n/a
2 ccsbBroad304_03675 pLX_304 0% 95.8% 95.2% V5 (many diffs) n/a
3 TRCN0000469330 CACCGTTACAGGCTTTCGCACTCG pLX_317 37.4% 95.8% 95.2% V5 (many diffs) n/a
Download CSV