Construct: ORF TRCN0000469445
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002467.1_s317c1
- Derived from:
- ccsbBroadEn_06704
- DNA Barcode:
- CCTCGGCCAACCGAACAACCATAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PDE4D (5144)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469445
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001197223.2 | 99.8% | 99.8% | 656C>T;1014G>A |
2 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001197221.2 | 97.3% | 96.9% | (many diffs) |
3 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001364603.1 | 97.3% | 96.9% | (many diffs) |
4 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001349243.2 | 92.4% | 91.6% | (many diffs) |
5 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001364604.1 | 92.4% | 91.6% | (many diffs) |
6 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001197222.2 | 87.4% | 86.6% | (many diffs) |
7 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_006203.4 | 75.9% | 75.3% | (many diffs) |
8 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001197220.2 | 75.3% | 74.6% | (many diffs) |
9 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001197219.2 | 74.4% | 73.7% | (many diffs) |
10 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001349242.1 | 73.1% | 72.5% | (many diffs) |
11 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001349241.2 | 69.3% | 68.6% | (many diffs) |
12 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_017009567.1 | 68.8% | 68.2% | (many diffs) |
13 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001197218.2 | 68.6% | 68% | (many diffs) |
14 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001165899.2 | 68.3% | 67.7% | (many diffs) |
15 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001364599.1 | 68.3% | 67.7% | (many diffs) |
16 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_011543471.2 | 68.3% | 67.7% | (many diffs) |
17 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_011543473.1 | 68.3% | 67.7% | (many diffs) |
18 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_017009566.1 | 68.3% | 67.7% | (many diffs) |
19 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_024446112.1 | 68.3% | 67.7% | (many diffs) |
20 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_011543469.1 | 64.1% | 63.6% | (many diffs) |
21 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_011543470.2 | 64.1% | 63.6% | (many diffs) |
22 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_017009565.1 | 64.1% | 63.6% | (many diffs) |
23 | human | 5144 | PDE4D | phosphodiesterase 4D | XM_024446110.1 | 64.1% | 63.6% | (many diffs) |
24 | human | 5144 | PDE4D | phosphodiesterase 4D | NM_001104631.2 | 63.2% | 62.6% | (many diffs) |
25 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517648.3 | 89% | 97.8% | (many diffs) |
26 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517649.3 | 86.6% | 94.9% | (many diffs) |
27 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517647.2 | 67.1% | 73.1% | (many diffs) |
28 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517646.3 | 66.3% | 72.3% | (many diffs) |
29 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517645.3 | 64.7% | 70.5% | (many diffs) |
30 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517644.2 | 61.1% | 66.6% | (many diffs) |
31 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | NM_011056.3 | 60.9% | 66.4% | (many diffs) |
32 | mouse | 238871 | Pde4d | phosphodiesterase 4D, cAMP ... | XM_006517643.1 | 56.7% | 61.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1620
- ORF length:
- 1554
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcc tgaagcaaac tatttactgt cagtgtcttg gggctacata aagtttaaaa 121 ggatgcttaa tcgggagctc acccatctct ctgaaatgag tcggtctgga aatcaagtgt 181 cagagtttat atcaaacaca ttcttagata agcaacatga agtggaaatt ccttctccaa 241 ctcagaagga aaaggagaaa aagaaaagac caatgtctca gatcagtgga gtcaagaaat 301 tgatgcacag ctctagtctg actaattcaa gtatcccaag gtttggagtt aaaactgaac 361 aagaagatgt ccttgccaag gaactagaag atgtgaacaa atggggtctt catgttttca 421 gaatagcaga gttgtctggt aaccggccct tgactgttat catgcacacc atttttcagg 481 aacgggattt attaaaaaca tttaaaattc cagtagatac tttaattaca tatcttatga 541 ctctcgaaga ccattaccat gctgatgtgg cctatcacaa caatatccat gctgcagatg 601 ttgtccagtc tactcatgtg ctattatcta cacctgcttt ggaggctgtg tttacagatt 661 tggagattct tgcagcaatt tttgccagtg caatacatga tgtagatcat cctggtgtgt 721 tcaatcaatt tctgatcaat acaaactctg aacttgcctt gatgtacaat gattcctcag 781 tcttagagaa ccatcatttg gctgtgggct ttaaattgct tcaggaagaa aactgtgaca 841 ttttccagaa tttgaccaaa aaacaaagac aatctttaag gaaaatggtc attgacatcg 901 tacttgcaac agatatgtca aaacacatga atctactggc tgatttgaag actatggttg 961 aaactaagaa agtgacaagc tctggagttc ttcttcttga taattattcc gataggattc 1021 aggttcttca gaatatggtg cactgtgcag atctgagcaa cccaacaaag cctctccaac 1081 tgtaccgcca gtggacggac cggataatgg aggagttctt ccgccaagga gaccgagaga 1141 gggaacgtgg catggagata agccccatgt gtgacaagca caatgcttcc gtggaaaaat 1201 cacaggtggg cttcatagac tatattgttc aTCCCCTCTG GGAGACATGG GCAGACCTCG 1261 TCCACCCTGA CGCCCAGGAT ATTTTGGACA CTTTGGAGGA CAATCGTGAA TGGTACCAGA 1321 GCACAATCCC TCAGAGCCCC TCTCCTGCAC CTGATGACCC AGAGGAGGGC CGGCAGGGTC 1381 AAACTGAGAA ATTCCAGTTT GAACTAACTT TAGAGGAAGA TGGTGAGTCA GACACGGAAA 1441 AGGACAGTGG CAGTCAAGTG GAAGAAGACA CTAGCTGCAG TGACTCCAAG ACTCTTTGTA 1501 CTCAAGACTC AGAGTCTACT GAAATTCCCC TTGATGAACA GGTTGAAGAG GAGGCAGTAG 1561 GGGAAGAAGA GGAAAGCCAG CCTGAAGCCT GTGTCATAGA TGATCGTTCT CCTGACACGT 1621 ACCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1681 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1741 TTTATATATC TTGTGGAAAG GACGACCTCG GCCAACCGAA CAACCATACA CGCGTTAAGT 1801 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt