Transcript: Mouse NM_011056.3

Mus musculus phosphodiesterase 4D, cAMP specific (Pde4d), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pde4d (238871)
Length:
7049
CDS:
181..2424

Additional Resources:

NCBI RefSeq record:
NM_011056.3
NBCI Gene record:
Pde4d (238871)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115009 GCTCCAGCCTAACTAATTCAT pLKO.1 1115 CDS 100% 5.625 4.500 N Pde4d n/a
2 TRCN0000115006 CGGAACAACTTTGCTGCGTTA pLKO.1 706 CDS 100% 4.050 3.240 N Pde4d n/a
3 TRCN0000115007 CCAGCCTAACTAATTCATGTA pLKO.1 1118 CDS 100% 4.950 3.465 N Pde4d n/a
4 TRCN0000115008 GCGAAGCGAATCAGAGAACAT pLKO.1 363 CDS 100% 4.950 3.465 N Pde4d n/a
5 TRCN0000115010 GCAAAGACAATCTTTAAGGAA pLKO.1 1668 CDS 100% 3.000 2.100 N Pde4d n/a
6 TRCN0000048836 CCATCAACAAAGCCACCATAA pLKO.1 782 CDS 100% 10.800 7.560 N PDE4D n/a
7 TRCN0000236068 GTGGGCTTCATAGACTATATT pLKO_005 2011 CDS 100% 15.000 9.000 N PDE4D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011056.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06704 pDONR223 100% 60.9% 66.4% None (many diffs) n/a
2 ccsbBroad304_06704 pLX_304 0% 60.9% 66.4% V5 (many diffs) n/a
3 TRCN0000469445 CCTCGGCCAACCGAACAACCATAC pLX_317 25.3% 60.9% 66.4% V5 (many diffs) n/a
Download CSV