Transcript: Human XM_011543473.1

PREDICTED: Homo sapiens phosphodiesterase 4D (PDE4D), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PDE4D (5144)
Length:
8033
CDS:
161..2407

Additional Resources:

NCBI RefSeq record:
XM_011543473.1
NBCI Gene record:
PDE4D (5144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011543473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236065 CCTAGTGTTTACCTGATTATA pLKO_005 4282 3UTR 100% 15.000 21.000 N PDE4D n/a
2 TRCN0000236069 TATCGATCCGACAGCGATTAT pLKO_005 554 CDS 100% 13.200 18.480 N PDE4D n/a
3 TRCN0000048833 CGGGCTAATTCTCCAAGCAAA pLKO.1 499 CDS 100% 4.950 6.930 N PDE4D n/a
4 TRCN0000048837 GCCAGTGATATACACGGAGAT pLKO.1 614 CDS 100% 4.050 5.670 N PDE4D n/a
5 TRCN0000236068 GTGGGCTTCATAGACTATATT pLKO_005 1991 CDS 100% 15.000 10.500 N PDE4D n/a
6 TRCN0000236067 CAGCTCTAGTCTGACTAATTC pLKO_005 1093 CDS 100% 13.200 9.240 N PDE4D n/a
7 TRCN0000048836 CCATCAACAAAGCCACCATAA pLKO.1 762 CDS 100% 10.800 7.560 N PDE4D n/a
8 TRCN0000236066 TTTGGAGGACAATCGTGAATG pLKO_005 2077 CDS 100% 10.800 7.560 N PDE4D n/a
9 TRCN0000048834 GCTATTATCTACACCTGCTTT pLKO.1 1405 CDS 100% 4.950 3.465 N PDE4D n/a
10 TRCN0000048835 CCTGTGTCATAGATGATCGTT pLKO.1 2373 CDS 100% 3.000 2.100 N PDE4D n/a
11 TRCN0000270331 ATGATGGGATGGTGTTGATTA pLKO_005 5667 3UTR 100% 13.200 9.240 N Teddm1b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011543473.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06704 pDONR223 100% 68.3% 67.7% None (many diffs) n/a
2 ccsbBroad304_06704 pLX_304 0% 68.3% 67.7% V5 (many diffs) n/a
3 TRCN0000469445 CCTCGGCCAACCGAACAACCATAC pLX_317 25.3% 68.3% 67.7% V5 (many diffs) n/a
4 ccsbBroadEn_11023 pDONR223 100% 23.2% 17.9% None (many diffs) n/a
5 ccsbBroad304_11023 pLX_304 0% 23.2% 17.9% V5 (many diffs) n/a
6 TRCN0000471607 GTCAGCGCGAATCGTGATTTCGTT pLX_317 79.6% 23.2% 17.9% V5 (many diffs) n/a
Download CSV