Construct: ORF TRCN0000469474
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007860.1_s317c1
- Derived from:
- ccsbBroadEn_01633
- DNA Barcode:
- AGCGCATCTCACACCTTTCGCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SYPL1 (6856)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469474
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 6856 | SYPL1 | synaptophysin like 1 | NM_006754.4 | 100% | 100% | |
2 | human | 6856 | SYPL1 | synaptophysin like 1 | NM_182715.3 | 93% | 93% | 0_1ins54 |
3 | mouse | 19027 | Sypl | synaptophysin-like protein | NM_198710.3 | 78.2% | 77.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 843
- ORF length:
- 777
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gcccaacatc tacttggttc gccagcggat cagtcgactc ggccagagga 121 tgtccggctt ccagatcaac ctcaacccgc tcaaggagcc actcggcttc atcaaggtcc 181 tcgagtggat tgcttctatc tttgcttttg ccacctgtgg aggttttaag ggccaaacag 241 aaattcaagt gaattgtcct cctgcagtta ctgagaataa aactgttaca gctacttttg 301 gttatccatt caggttgaat gaggcatcat ttcagccacc tccaggtgta aacatatgtg 361 atgtaaattg gaaagattac gtcctcatag gcgattactc ttcttctgca caattctatg 421 ttacctttgc agtctttgtg ttcctgtact gcattgctgc ccttctgctt tatgttGGCT 481 ACACGAGTCT GTATCTGGAT AGTCGTAAAC TTCCTATGAT AGACTTTGTT GTTACACTTG 541 TTGCCACTTT TTTGTGGTTG GTGAGCACTT CAGCCTGGGC TAAAGCTCTG ACAGATATTA 601 AAATAGCTAC TGGTCACAAT ATTATTGATG AACTTCCGCC TTGTAAGAAG AAAGCAGTAC 661 TGTGTTACTT TGGCTCTGTG ACCAGTATGG GATCCCTAAA TGTATCTGTG ATATTTGGCT 721 TTCTAAATAT GATACTCTGG GGAGGAAATG CTTGGTTTGT GTACAAGGAG ACCAGCCTAC 781 ACAGTCCATC AAATACATCT GCCCCTCATA GCCAAGGAGG TATTCCACCT CCTACCGGAA 841 TATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGAAG CGCATCTCAC ACCTTTCGCA CTACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt