Transcript: Mouse NM_198710.3

Mus musculus synaptophysin-like protein (Sypl), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Sypl (19027)
Length:
4615
CDS:
106..837

Additional Resources:

NCBI RefSeq record:
NM_198710.3
NBCI Gene record:
Sypl (19027)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348455 AGCTTACACAGTCCGTCAAAT pLKO_005 766 CDS 100% 13.200 18.480 N Sypl n/a
2 TRCN0000093501 CCTGAATGTATCCGTGATCTT pLKO.1 687 CDS 100% 4.950 6.930 N Sypl n/a
3 TRCN0000093500 GCACAGTTCTACGTTACGTTT pLKO.1 397 CDS 100% 4.950 6.930 N Sypl n/a
4 TRCN0000334819 GCACAGTTCTACGTTACGTTT pLKO_005 397 CDS 100% 4.950 6.930 N Sypl n/a
5 TRCN0000093503 CCCATGATCGACTTTATTGTT pLKO.1 502 CDS 100% 5.625 4.500 N Sypl n/a
6 TRCN0000093499 GCCTGTTATGAGATGATGTTA pLKO.1 1047 3UTR 100% 5.625 4.500 N Sypl n/a
7 TRCN0000334821 GCCTGTTATGAGATGATGTTA pLKO_005 1047 3UTR 100% 5.625 4.500 N Sypl n/a
8 TRCN0000093502 CCTTCTGCTCTATGTTGGTTA pLKO.1 450 CDS 100% 4.950 3.465 N Sypl n/a
9 TRCN0000334902 CCTTCTGCTCTATGTTGGTTA pLKO_005 450 CDS 100% 4.950 3.465 N Sypl n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01632 pDONR223 100% 84% 83.1% None (many diffs) n/a
2 ccsbBroad304_01632 pLX_304 0% 84% 83.1% V5 (many diffs) n/a
3 TRCN0000468182 TTCTGGAACAGGACCTATCTACCT pLX_317 63.1% 84% 83.1% V5 (many diffs) n/a
4 ccsbBroadEn_01633 pDONR223 100% 78.2% 77.3% None (many diffs) n/a
5 ccsbBroad304_01633 pLX_304 0% 78.2% 77.3% V5 (many diffs) n/a
6 TRCN0000469474 AGCGCATCTCACACCTTTCGCACT pLX_317 47.3% 78.2% 77.3% V5 (many diffs) n/a
Download CSV