Transcript: Human NM_006754.4

Homo sapiens synaptophysin like 1 (SYPL1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
SYPL1 (6856)
Length:
2270
CDS:
48..827

Additional Resources:

NCBI RefSeq record:
NM_006754.4
NBCI Gene record:
SYPL1 (6856)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006754.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000059925 GCCTACACAGTCCATCAAATA pLKO.1 757 CDS 100% 13.200 18.480 N SYPL1 n/a
2 TRCN0000059927 CCGCCTTGTAAGAAGAAAGCA pLKO.1 618 CDS 100% 3.000 4.200 N SYPL1 n/a
3 TRCN0000300795 CCGCCTTGTAAGAAGAAAGCA pLKO_005 618 CDS 100% 3.000 4.200 N SYPL1 n/a
4 TRCN0000059924 CCAGGTGTAAACATATGTGAT pLKO.1 324 CDS 100% 0.000 0.000 N SYPL1 n/a
5 TRCN0000300806 CCAGGTGTAAACATATGTGAT pLKO_005 324 CDS 100% 0.000 0.000 N SYPL1 n/a
6 TRCN0000059926 CCTCGAGTGGATTGCTTCTAT pLKO.1 161 CDS 100% 0.000 0.000 N SYPL1 n/a
7 TRCN0000300793 CCTCGAGTGGATTGCTTCTAT pLKO_005 161 CDS 100% 0.000 0.000 N SYPL1 n/a
8 TRCN0000059923 CCTATGATAGACTTTGTTGTT pLKO.1 495 CDS 100% 4.950 2.970 N SYPL1 n/a
9 TRCN0000300794 CCTATGATAGACTTTGTTGTT pLKO_005 495 CDS 100% 4.950 2.970 N SYPL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006754.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01633 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01633 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469474 AGCGCATCTCACACCTTTCGCACT pLX_317 47.3% 100% 100% V5 n/a
4 ccsbBroadEn_01632 pDONR223 100% 93% 93% None 1_54del n/a
5 ccsbBroad304_01632 pLX_304 0% 93% 93% V5 1_54del n/a
6 TRCN0000468182 TTCTGGAACAGGACCTATCTACCT pLX_317 63.1% 93% 93% V5 1_54del n/a
Download CSV