Construct: ORF TRCN0000469483
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014823.1_s317c1
- Derived from:
- ccsbBroadEn_08656
- DNA Barcode:
- CCAGCGGAACGGAGGATGATAAAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BDH2 (56898)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469483
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | NM_020139.4 | 99.8% | 99.5% | 209A>G |
| 2 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | XM_011532128.2 | 99.8% | 99.5% | 209A>G |
| 3 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | XM_017008462.2 | 99.8% | 99.5% | 209A>G |
| 4 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | XM_006714274.3 | 94.4% | 93.8% | 209A>G;419_460del |
| 5 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | XM_011532127.2 | 94.4% | 93.8% | 209A>G;419_460del |
| 6 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | XM_017008461.2 | 94.4% | 93.8% | 209A>G;419_460del |
| 7 | human | 56898 | BDH2 | 3-hydroxybutyrate dehydroge... | XM_005263140.3 | 84.3% | 84% | 209A>G;416_417ins114 |
| 8 | mouse | 69772 | Bdh2 | 3-hydroxybutyrate dehydroge... | NM_027208.2 | 85.3% | 91% | (many diffs) |
| 9 | mouse | 69772 | Bdh2 | 3-hydroxybutyrate dehydroge... | NM_001172055.1 | 81.9% | 87.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 801
- ORF length:
- 735
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tcgacttgat gggaaagtca tcatcctgac ggccgctgct caggggattg 121 gccaagcagc tgccttagct tttgcaagag aaggtgccaa agtcatagcc acagacatta 181 atgagtccaa acttcaggaa ctggaaaagt acccgggtat tcaaactcgt gtccttgatg 241 tcacaaagaa gaaacaaatt gatcagtttg ccagtgaagt tgagagactt gatgttctct 301 ttaatgttgc tggttttgtc catcatggaa ctgtcctgga ttgtgaggag aaagactggg 361 acttctcgat gaatctcaat gtgcgcagca tgtacctgat gatcaaggca ttccttccTA 421 AAATGCTTGC TCAGAAATCT GGCAATATTA TCAACATGTC TTCTGTGGCT TCCAGCGTCA 481 AAGGAGTTGT GAACAGATGT GTGTACAGCA CAACCAAGGC AGCCGTGATT GGCCTCACAA 541 AATCTGTGGC TGCAGATTTC ATCCAGCAGG GCATCAGGTG CAACTGTGTG TGCCCAGGAA 601 CAGTTGATAC GCCATCTCTA CAAGAAAGAA TACAAGCCAG AGGAAATCCT GAAGAGGCAC 661 GGAATGATTT CCTGAAGAGA CAAAAGACGG GAAGATTCGC AACTGCAGAA GAAATAGCCA 721 TGCTCTGCGT GTATTTGGCT TCTGATGAAT CTGCTTATGT AACTGGTAAC CCTGTCATCA 781 TTGATGGAGG CTGGAGCTTG TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 841 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 901 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACCAG CGGAACGGAG 961 GATGATAAAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt