Transcript: Mouse NM_001172055.1

Mus musculus 3-hydroxybutyrate dehydrogenase, type 2 (Bdh2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Bdh2 (69772)
Length:
1172
CDS:
200..967

Additional Resources:

NCBI RefSeq record:
NM_001172055.1
NBCI Gene record:
Bdh2 (69772)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001172055.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041860 CGGACGAGTCAGCCTATGTAA pLKO.1 906 CDS 100% 5.625 7.875 N Bdh2 n/a
2 TRCN0000041861 CGAGAGAATTGATGTTCTCTT pLKO.1 445 CDS 100% 0.495 0.693 N Bdh2 n/a
3 TRCN0000041858 GCTGGAAAGTTACCGAGGTAT pLKO.1 364 CDS 100% 4.950 3.960 N Bdh2 n/a
4 TRCN0000041862 CCATCTCTGCAAGAAAGAATA pLKO.1 776 CDS 100% 13.200 9.240 N Bdh2 n/a
5 TRCN0000041859 CCAAAGTCATAGCCACAGATA pLKO.1 321 CDS 100% 4.950 3.465 N Bdh2 n/a
6 TRCN0000046506 CCTTGATGTCACAAAGAAGAA pLKO.1 397 CDS 100% 4.950 3.465 N BDH2P1 n/a
7 TRCN0000036737 CCAAAGTCATAGCCACAGACA pLKO.1 321 CDS 100% 2.640 1.848 N BDH2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172055.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08656 pDONR223 100% 81.9% 87.4% None (many diffs) n/a
2 ccsbBroad304_08656 pLX_304 0% 81.9% 87.4% V5 (many diffs) n/a
3 TRCN0000469483 CCAGCGGAACGGAGGATGATAAAC pLX_317 52% 81.9% 87.4% V5 (many diffs) n/a
Download CSV