Construct: ORF TRCN0000469503
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013432.1_s317c1
- Derived from:
- ccsbBroadEn_04392
- DNA Barcode:
- TTCACCACTTTACTGCAACAGCAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LZTS2 (84445)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469503
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 84445 | LZTS2 | leucine zipper tumor suppre... | NM_001318099.2 | 100% | 100% | |
| 2 | human | 84445 | LZTS2 | leucine zipper tumor suppre... | NM_001318100.2 | 100% | 100% | |
| 3 | human | 84445 | LZTS2 | leucine zipper tumor suppre... | NM_032429.4 | 100% | 100% | |
| 4 | human | 84445 | LZTS2 | leucine zipper tumor suppre... | XM_005270222.4 | 100% | 100% | |
| 5 | human | 84445 | LZTS2 | leucine zipper tumor suppre... | NM_001318101.1 | 67.1% | 67.1% | 406_407ins660 |
| 6 | human | 84445 | LZTS2 | leucine zipper tumor suppre... | XM_017016781.1 | 67.1% | 67.1% | 406_407ins660 |
| 7 | mouse | 226154 | Lzts2 | leucine zipper, putative tu... | NM_001130525.1 | 86.5% | 91.6% | (many diffs) |
| 8 | mouse | 226154 | Lzts2 | leucine zipper, putative tu... | NM_001130526.1 | 86.5% | 91.6% | (many diffs) |
| 9 | mouse | 226154 | Lzts2 | leucine zipper, putative tu... | NM_145503.2 | 86.5% | 91.6% | (many diffs) |
| 10 | mouse | 226154 | Lzts2 | leucine zipper, putative tu... | XM_006527004.3 | 86.5% | 91.6% | (many diffs) |
| 11 | mouse | 226154 | Lzts2 | leucine zipper, putative tu... | XM_006527005.3 | 58.9% | 61% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2073
- ORF length:
- 2007
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cattgtgcag actctgccag tgccactgga gcctgctcct gaagctgcca 121 ctgccccaca agctccagtc atgggtagtg tgagcagcct tatctcaggc cggccctgtc 181 ccggggggcc agctcctccc cgccaccacg gccctcctgg gcccaccttc ttccgccagc 241 aggatggcct gctacggggt ggctatgagg cacaggagcc gctgtgccca gctgtgcccc 301 ctaggaaggc tgtccctgtc accagcttca cctacatcaa tgaggacttc cggacagagt 361 caccccccag cccaagcagt gatgttgagg atgcccgaga gcagcgggca cacaatgccc 421 acctccgcgg cccaccacca aagctcatcc ctgtctctgg aaagctggag aagaacatgg 481 agaagatcct gatccgccca acagccttca agccagtgct gcccaaacct cgaggggctc 541 cgtccctgcc tagcttcatg ggtcctcggg ccaccgggct gtctgggagc cagggcagcc 601 tgacgcagct gtttgggggc cctgcctcct cctcctcctc ttcctcctcc tcttcagctg 661 ctgacaaacc cctggcattt agtggctggg ccagtggctg cccatcaggg acgctatccg 721 actctggccg aaactcactg tccagcctgc ccacctacag caccggaggt gccgagccaa 781 ccaccagctc cccaggcggg cacctgcctt cccatggctc tgggcgaggg gcactgcctg 841 ggccagcccg aggggtccct actgggccct cccactcaga cagtggccgg tcctcctcca 901 gcaagagcac aggctcccta gggggccgtg tggctggggg gcttttgggc agtggtactc 961 gggcctcccc tgacagcagc tcctgtgggg agcgctcacc accacccccg cctccacctc 1021 cttcggatga ggccctgctg cactgtgtcc tggaaggaaa gctccgagac cgggaggcag 1081 agcttcagca gctgcgggac agtctggacg agaatgaggc taccatgtgc caggcatacg 1141 aggagcggca gcggcactgg cagcgagagc gtgaggccct gcgagaggac tgtgcggccc 1201 aggcacagcg ggcacagcgg gcccaacagc tgctgcagct gcaggtgttc cagctgcagc 1261 aggagaagcg gcaattgcag gacgacttcg cacagctgct gcaggagcgc gaacagctgg 1321 agcggcgctg cgccaccttg gagcgggagc agcgggagct cgggccgagg cttgaggaga 1381 ccaagtggga ggtgtgccag aaatcaggcg agatctccct gctgaagcag cagctgaaag 1441 agtctcaggc agagctggtg cagaagggca gcgagctggt ggctctgcgg gtggcgctgc 1501 gggaggcccg tgctacgctg cgggtcagtg agggccgtgc gcggggtcta caggaggccg 1561 cccgagctcg ggagctggag ctggaagcct gttcccagga gctgcagcga caccgccagg 1621 aagctgagca gctgcgggag aaagctgggc agttggatgc tgaggcggcc ggacTCCGGG 1681 AGCCCCCTGT GCCACCTGCC ACCGCTGACC CATTCCTCCT GGCAGAGAGT GATGAGGCCA 1741 AAGTGCAGCG GGCAGCAGCC GGGGTTGGGG GCAGCTTGCG GGCCCAGGTG GAGCGATTGC 1801 GGGTGGAGCT GCAGCGGGAG CGGCGGCGGG GTGAGGAGCA GCGGGACAGC TTTGAGGGGG 1861 AGCGGCTGGC CTGGCAGGCA GAGAAGGAGC AGGTGATCCG CTACCAGAAG CAGCTGCAGC 1921 ACAACTACAT CCAGATGTAC CGGCGCAACC GGCAGCTAGA GCAGGAGCTG CAGCAGCTCA 1981 GCCTGGAGCT GGAGGCCCGG GAGCTCGCTG ACCTGGGCCT GGCCGAGCAG GCCCCCTGCA 2041 TCTGCCTGGA GGAGATCACT GCTACTGAGA TCTACCCAAC TTTCTTGTAC AAAGTGGTTG 2101 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 2161 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGATT 2221 CACCACTTTA CTGCAACAGC AGACGCGTTA AGTCgacaat caacctctgg attacaaaat 2281 ttgtgaaaga tt