Transcript: Human XM_017016781.1

PREDICTED: Homo sapiens leucine zipper tumor suppressor 2 (LZTS2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LZTS2 (84445)
Length:
2230
CDS:
213..1562

Additional Resources:

NCBI RefSeq record:
XM_017016781.1
NBCI Gene record:
LZTS2 (84445)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412326 GCAAGATCAGACCGCTCAAAG pLKO_005 1742 3UTR 100% 10.800 8.640 N LZTS2 n/a
2 TRCN0000419617 GAAGCAGCTGCAGCACAACTA pLKO_005 1394 CDS 100% 4.950 3.465 N LZTS2 n/a
3 TRCN0000021127 GATCACTGCTACTGAGATCTA pLKO.1 1541 CDS 100% 4.950 3.465 N LZTS2 n/a
4 TRCN0000021125 GCAGAGAGTGATGAGGCCAAA pLKO.1 1209 CDS 100% 4.050 2.835 N LZTS2 n/a
5 TRCN0000021124 CCAAGCAGTGATGTTGAGGAT pLKO.1 519 CDS 100% 2.640 1.848 N LZTS2 n/a
6 TRCN0000021126 CTCTGGAAAGCTGGAGAAGAA pLKO.1 602 CDS 100% 4.950 2.970 N LZTS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016781.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04392 pDONR223 100% 67.1% 67.1% None 406_407ins660 n/a
2 ccsbBroad304_04392 pLX_304 0% 67.1% 67.1% V5 406_407ins660 n/a
3 TRCN0000469503 TTCACCACTTTACTGCAACAGCAG pLX_317 20.1% 67.1% 67.1% V5 406_407ins660 n/a
4 ccsbBroadEn_09189 pDONR223 100% 67% 67.1% None 406_407ins660;558C>T;999A>G n/a
5 ccsbBroad304_09189 pLX_304 0% 67% 67.1% V5 406_407ins660;558C>T;999A>G n/a
6 TRCN0000466280 AAAATAGAGTATAACAAAGCAATT pLX_317 18.1% 67% 67.1% V5 406_407ins660;558C>T;999A>G n/a
Download CSV