Transcript: Mouse XM_006527005.3

PREDICTED: Mus musculus leucine zipper, putative tumor suppressor 2 (Lzts2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Lzts2 (226154)
Length:
2870
CDS:
888..2240

Additional Resources:

NCBI RefSeq record:
XM_006527005.3
NBCI Gene record:
Lzts2 (226154)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006527005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042463 CCCAGCAATGTCTTGTTTATT pLKO.1 2664 3UTR 100% 15.000 21.000 N Lzts2 n/a
2 TRCN0000042466 CCAGGCAATAGCTTTACCTAT pLKO.1 1137 CDS 100% 4.950 3.465 N Lzts2 n/a
3 TRCN0000042467 CGCCAGTTGCAGGATGACTTT pLKO.1 1434 CDS 100% 4.950 3.465 N Lzts2 n/a
4 TRCN0000419617 GAAGCAGCTGCAGCACAACTA pLKO_005 2072 CDS 100% 4.950 3.465 N LZTS2 n/a
5 TRCN0000042465 GCACAACTATATCCAGATGTA pLKO.1 2084 CDS 100% 4.950 3.465 N Lzts2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 494 5UTR 100% 4.950 2.475 Y KAAG1 n/a
7 TRCN0000021125 GCAGAGAGTGATGAGGCCAAA pLKO.1 1887 CDS 100% 4.050 2.430 N LZTS2 n/a
8 TRCN0000021126 CTCTGGAAAGCTGGAGAAGAA pLKO.1 1277 CDS 100% 4.950 3.465 N LZTS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006527005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04392 pDONR223 100% 58.9% 61% None (many diffs) n/a
2 ccsbBroad304_04392 pLX_304 0% 58.9% 61% V5 (many diffs) n/a
3 TRCN0000469503 TTCACCACTTTACTGCAACAGCAG pLX_317 20.1% 58.9% 61% V5 (many diffs) n/a
4 ccsbBroadEn_09189 pDONR223 100% 58.9% 61% None (many diffs) n/a
5 ccsbBroad304_09189 pLX_304 0% 58.9% 61% V5 (many diffs) n/a
6 TRCN0000466280 AAAATAGAGTATAACAAAGCAATT pLX_317 18.1% 58.9% 61% V5 (many diffs) n/a
Download CSV