Construct: ORF TRCN0000469511
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014003.1_s317c1
- Derived from:
- ccsbBroadEn_03257
- DNA Barcode:
- GCGGGCTACGACACTAGAGAAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TBC1D7 (51256)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469511
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_001143964.3 | 100% | 100% | |
| 2 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_001143965.3 | 100% | 100% | |
| 3 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_001318805.1 | 100% | 100% | |
| 4 | human | 107080638 | TBC1D7-LOC100130357 | TBC1D7-LOC100130357 readthr... | NM_001318809.1 | 100% | 100% | |
| 5 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_016495.6 | 100% | 100% | |
| 6 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_001143966.3 | 90.7% | 90.7% | 111_112ins81 |
| 7 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_001258457.2 | 84.3% | 84.3% | 379_380ins138 |
| 8 | human | 107080638 | TBC1D7-LOC100130357 | TBC1D7-LOC100130357 readthr... | NR_134872.2 | 48.2% | (many diffs) | |
| 9 | human | 51256 | TBC1D7 | TBC1 domain family member 7 | NM_001318806.2 | 46.2% | 37% | (many diffs) |
| 10 | mouse | 67046 | Tbc1d7 | TBC1 domain family, member 7 | NM_001252639.1 | 84.7% | 90.7% | (many diffs) |
| 11 | mouse | 67046 | Tbc1d7 | TBC1 domain family, member 7 | NM_025935.3 | 84.7% | 90.7% | (many diffs) |
| 12 | mouse | 67046 | Tbc1d7 | TBC1 domain family, member 7 | NM_001252640.1 | 72.9% | 77.8% | (many diffs) |
| 13 | mouse | 67046 | Tbc1d7 | TBC1 domain family, member 7 | XM_006516945.3 | 69% | 73.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 945
- ORF length:
- 879
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac tgaggactct cagagaaact ttcgttcagt atattatgag aaagtggggt 121 ttcgtggagt tgaagaaaag aaatcattag aaattctcct aaaagatgac cgtctggata 181 ctgagaaact ttgtactttt agtcagaggt tccctctccc gtccatgtac cgtgcattgg 241 tatggaaggt gcttctagga atcttgcctc cacaccacga gtcccatgcc aaggtgatga 301 tgtatcgtaa ggagcagtac ttggatgtcc ttcatgccct gaaagtcgtt cgctttgtta 361 gtgatgccac acctcaggct gaagtctatc tccgcatgta tcagctggag tctgggaagt 421 tacctcgaag tccctctttt ccactggagc cagatgatga agtgtttctt gccatagcta 481 aagccatgga ggaaatggtg gaagatagtg tcgactgtta ctggatcacc cgacgctttg 541 tgaaccaatt aaataccaag taccgggatt CCTTGCCCCA GTTGCCAAAA GCGTTTGAAC 601 AATACTTGAA TCTGGAAGAT GGCAGACTGC TGACTCATCT GAGGATGTGT TCCGCGGCGC 661 CCAAACTTCC TTATGATCTC TGGTTCAAGA GGTGCTTTGC GGGATGTTTG CCTGAATCCA 721 GTTTACAGAG GGTTTGGGAT AAAGTTGTGA GTGGATCCTG TAAGATCCTA GTTTTTGTAG 781 CTGTCGAAAT TTTATTAACC TTTAAAATAA AAGTTATGGC ACTGAACAGT GCAGAGAAGA 841 TAACAAAGTT TCTGGAAAAT ATTCCCCAGG ACAGCTCAGA CGCGATCGTG AGCAAGGCCA 901 TTGACTTGTG GCACAAACAC TGTGGGACCC CGGTCCATTC AAGCTGCCCA ACTTTCTTGT 961 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1021 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1081 GAAAGGACGA GCGGGCTACG ACACTAGAGA AAGTACGCGT TAAGTCgaca atcaacctct 1141 ggattacaaa atttgtgaaa gatt