Transcript: Human NM_001143966.3

Homo sapiens TBC1 domain family member 7 (TBC1D7), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-03-25
Taxon:
Homo sapiens (human)
Gene:
TBC1D7 (51256)
Length:
1099
CDS:
137..937

Additional Resources:

NCBI RefSeq record:
NM_001143966.3
NBCI Gene record:
TBC1D7 (51256)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001143966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423810 ACGCTTTGTGAACCAATTAAA pLKO_005 523 CDS 100% 15.000 7.500 Y TBC1D7 n/a
2 TRCN0000416361 GTTGTGAGTGGATCCTGTAAG pLKO_005 734 CDS 100% 10.800 5.400 Y TBC1D7 n/a
3 TRCN0000423117 TGCGGGATGTTTGCCTGAATC pLKO_005 688 CDS 100% 10.800 5.400 Y TBC1D7 n/a
4 TRCN0000133955 CAAGGTGATGATGTATCGTAA pLKO.1 280 CDS 100% 4.950 2.475 Y TBC1D7 n/a
5 TRCN0000135506 GCCCAAACTTCCTTATGATCT pLKO.1 649 CDS 100% 4.950 2.475 Y TBC1D7 n/a
6 TRCN0000135561 GTCGTTCGCTTTGTTAGTGAT pLKO.1 335 CDS 100% 4.950 2.475 Y TBC1D7 n/a
7 TRCN0000138287 CGTAAGGAGCAGTACTTGGAT pLKO.1 296 CDS 100% 3.000 1.500 Y TBC1D7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001143966.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15835 pDONR223 0% 100% 100% None n/a
2 ccsbBroad304_15835 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000465988 CCTAACGGGCAGTGTTTTATGTAT pLX_317 51.8% 100% 100% V5 n/a
4 ccsbBroadEn_03257 pDONR223 100% 90.7% 90.7% None 111_112ins81 n/a
5 ccsbBroad304_03257 pLX_304 0% 90.7% 90.7% V5 111_112ins81 n/a
6 TRCN0000469511 GCGGGCTACGACACTAGAGAAAGT pLX_317 42.8% 90.7% 90.7% V5 111_112ins81 n/a
Download CSV