Transcript: Mouse XM_006516945.3

PREDICTED: Mus musculus TBC1 domain family, member 7 (Tbc1d7), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d7 (67046)
Length:
1055
CDS:
179..901

Additional Resources:

NCBI RefSeq record:
XM_006516945.3
NBCI Gene record:
Tbc1d7 (67046)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006516945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243861 AGGCGCTTCTAGGCATCTTAC pLKO_005 201 CDS 100% 10.800 15.120 N Tbc1d7 n/a
2 TRCN0000183267 GAAGTGTATCTTCGCATGTAT pLKO.1 335 CDS 100% 5.625 7.875 N Tbc1d7 n/a
3 TRCN0000243862 TAGCGGTAGAAATACTATTAA pLKO_005 732 CDS 100% 15.000 10.500 N Tbc1d7 n/a
4 TRCN0000243865 TCGAGAAGCTTTGCACATTTA pLKO_005 135 5UTR 100% 13.200 9.240 N Tbc1d7 n/a
5 TRCN0000243864 ACAAGTACAGGGACGCTTTAC pLKO_005 510 CDS 100% 10.800 7.560 N Tbc1d7 n/a
6 TRCN0000243863 TCCGCACCATGACACTCATTC pLKO_005 223 CDS 100% 10.800 7.560 N Tbc1d7 n/a
7 TRCN0000180645 CAAAGACCAGTACCATGACAT pLKO.1 262 CDS 100% 4.950 2.970 N Tbc1d7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006516945.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15835 pDONR223 0% 74.5% 77.8% None (many diffs) n/a
2 ccsbBroad304_15835 pLX_304 0% 74.5% 77.8% V5 (many diffs) n/a
3 TRCN0000465988 CCTAACGGGCAGTGTTTTATGTAT pLX_317 51.8% 74.5% 77.8% V5 (many diffs) n/a
4 ccsbBroadEn_03257 pDONR223 100% 69% 73.3% None (many diffs) n/a
5 ccsbBroad304_03257 pLX_304 0% 69% 73.3% V5 (many diffs) n/a
6 TRCN0000469511 GCGGGCTACGACACTAGAGAAAGT pLX_317 42.8% 69% 73.3% V5 (many diffs) n/a
Download CSV