Construct: ORF TRCN0000469569
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF001388.1_s317c1
- Derived from:
- ccsbBroadEn_09266
- DNA Barcode:
- AAGTTAAAACGCCTCAAAGTTAGA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CIPC (85457)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469569
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 85457 | CIPC | CLOCK interacting pacemaker | NM_033426.3 | 99.9% | 99.7% | 91C>T |
| 2 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | NM_001289430.1 | 81.3% | 82.8% | (many diffs) |
| 3 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | NM_173735.3 | 81.3% | 82.8% | (many diffs) |
| 4 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_006515712.3 | 81.3% | 82.8% | (many diffs) |
| 5 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_017315031.1 | 81.3% | 82.8% | (many diffs) |
| 6 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_017315032.1 | 81.3% | 82.8% | (many diffs) |
| 7 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_011244078.2 | 77.4% | 78.8% | (many diffs) |
| 8 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | NM_001289429.1 | 72.2% | 73.6% | (many diffs) |
| 9 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | NM_001289431.1 | 72.2% | 73.6% | (many diffs) |
| 10 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | NM_001289432.1 | 72.2% | 73.6% | (many diffs) |
| 11 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_006515713.3 | 72.2% | 73.6% | (many diffs) |
| 12 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_006515714.3 | 72.2% | 73.6% | (many diffs) |
| 13 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_011244079.2 | 72.2% | 73.6% | (many diffs) |
| 14 | mouse | 217732 | Cipc | CLOCK interacting protein, ... | XM_006515710.3 | 69.6% | 70.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1263
- ORF length:
- 1197
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gaggaaaaac ccatccagag agagccccag aagactctct gccaaagtag 121 gcaaaggcac agagatgaag aaagtggctc gtcagtttgg gatggctgct gctgagtcag 181 acaaggactc tggcttttca gatgggagct cggaatgtct gagctctgca gagcagatgg 241 agtccgagga catgctgagc gccttaggct ggagcagaga agacaggccg aggcagaact 301 ccaaaactgc aaagaatgcc ttccctaccc tgtctcccat ggtcgtcatg aagaatgtgc 361 ttgtcaaaca gggcagcagc tcatcccagc tccagtcgtg gactgtccag ccctcctttg 421 aagtgatctc agcacagcca cagctcttat tccttcatcc acctgtacca tctcctgtca 481 gtccatgtca cactggtgag aaaaagtccg actccaggaa ctacttgccc attctgaatt 541 cttacaccaa aatagcccca catccaggca aaaggggcct ttcccttggc ccagaagaaa 601 aaggaacaag tggagtgcag aagaaaatct gtactgagag acttgggcct agcttgtctt 661 ccagtgagcc aaccaaggct ggtgctgtcc catccagtcc ctcgacgcca gcaccaccca 721 gcgccaaact tgccgaggac tcagctctgc agggtgtgcc ctctctggtg gcaggtggaa 781 gtccacagac TCTTCAGCCG GTATCCAGCA GTCACGTGGC TAAAGCTCCC AGTCTGACCT 841 TCGCTTCCCC CGCCAGTCCT GTCTGCGCAT CAGACAGCAC TCTCCATGGG TTAGAGAGCA 901 ACTCTCCCCT TTCACCACTG TCCGCTAATT ATAGCTCACC TTTATGGGCT GCAGAGCACC 961 TCTGCCGCAG CCCAGATATC TTTTCAGAGC AGCGGCAGAG CAAACATAGG CGCTTTCAGA 1021 ATACCCTAGT AGTCCTACAT AAATCTGGTT TGCTGGAGAT CACTTTGAAA ACCAAGGAGT 1081 TGATTCGTCA GAATCAGGCA ACTCAGGTAG AACTAGACCA GCTAAAGGAG CAAACCCAGC 1141 TGTTTATAGA AGCCACCAAG AGCAGGGCCC CTCAGGCTTG GGCCAAGCTG CAGGCATCTT 1201 TAACACCTGG GTCCAGTAAT ACAGGCAGTG ACCTAGAAGC ATTCTCTGAT CACCCAGCCA 1261 TATACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1321 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1381 GGCTTTATAT ATCTTGTGGA AAGGACGAAA GTTAAAACGC CTCAAAGTTA GAACGCGTTA 1441 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt