Transcript: Human NM_033426.3

Homo sapiens CLOCK interacting pacemaker (CIPC), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
CIPC (85457)
Length:
4325
CDS:
157..1356

Additional Resources:

NCBI RefSeq record:
NM_033426.3
NBCI Gene record:
CIPC (85457)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_033426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263285 TTAGCGATGAATAACGTAATT pLKO_005 3897 3UTR 100% 13.200 18.480 N CIPC n/a
2 TRCN0000216674 CAAGGAGTTGATTCGTCAGAA pLKO.1 1164 CDS 100% 4.950 6.930 N Cipc n/a
3 TRCN0000282558 ATATAGCACAGAGGCATATTT pLKO_005 1351 CDS 100% 15.000 10.500 N CIPC n/a
4 TRCN0000282557 TAACACCTGGGTCCAGTAATA pLKO_005 1292 CDS 100% 13.200 9.240 N CIPC n/a
5 TRCN0000263287 TTTCACCACTGTCCGCTAATT pLKO_005 1001 CDS 100% 13.200 9.240 N CIPC n/a
6 TRCN0000168015 CCAGAGGTGTAATGTTGGTTA pLKO.1 2506 3UTR 100% 4.950 3.465 N CIPC n/a
7 TRCN0000172459 CAGCCACAGCTCTTATTCCTT pLKO.1 526 CDS 100% 3.000 2.100 N CIPC n/a
8 TRCN0000263286 TACCCTAGTAGTCCTACATAA pLKO_005 1113 CDS 100% 0.000 0.000 N CIPC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_033426.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09266 pDONR223 100% 99.9% 99.7% None 91C>T n/a
2 ccsbBroad304_09266 pLX_304 0% 99.9% 99.7% V5 91C>T n/a
3 TRCN0000469569 AAGTTAAAACGCCTCAAAGTTAGA pLX_317 39.6% 99.9% 99.7% V5 91C>T n/a
Download CSV