Transcript: Mouse XM_006515713.3

PREDICTED: Mus musculus CLOCK interacting protein, circadian (Cipc), transcript variant X7, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cipc (217732)
Length:
3321
CDS:
556..1578

Additional Resources:

NCBI RefSeq record:
XM_006515713.3
NBCI Gene record:
Cipc (217732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006515713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000264676 CAAGTTGCAGGCATCACTAAC pLKO_005 1497 CDS 100% 10.800 15.120 N Cipc n/a
2 TRCN0000215758 GCCCATTCTAAATTCTTATAC pLKO.1 846 CDS 100% 13.200 10.560 N Cipc n/a
3 TRCN0000283117 GAGCAAACCCAGATGTTTATA pLKO_005 1441 CDS 100% 15.000 10.500 N Cipc n/a
4 TRCN0000264674 CACCTATACAAGTAGGCAATA pLKO_005 2182 3UTR 100% 10.800 7.560 N Cipc n/a
5 TRCN0000264673 TCTGATCACCCAGACGTATAG pLKO_005 1558 CDS 100% 10.800 7.560 N Cipc n/a
6 TRCN0000216674 CAAGGAGTTGATTCGTCAGAA pLKO.1 1386 CDS 100% 4.950 3.465 N Cipc n/a
7 TRCN0000201987 CAGAACAAGCATAGGCGCTTT pLKO.1 1309 CDS 100% 4.050 2.835 N Cipc n/a
8 TRCN0000200980 CCACAGCCTATTTAAGAGCTT pLKO.1 1640 3UTR 100% 2.640 1.848 N Cipc n/a
9 TRCN0000264675 CCAAGACTGGCCGAGTATTAT pLKO_005 986 CDS 100% 15.000 9.000 N Cipc n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006515713.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09266 pDONR223 100% 72.2% 73.6% None (many diffs) n/a
2 ccsbBroad304_09266 pLX_304 0% 72.2% 73.6% V5 (many diffs) n/a
3 TRCN0000469569 AAGTTAAAACGCCTCAAAGTTAGA pLX_317 39.6% 72.2% 73.6% V5 (many diffs) n/a
Download CSV