Construct: ORF TRCN0000469590
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018319.1_s317c1
- Derived from:
- ccsbBroadEn_11308
- DNA Barcode:
- ATCGCCAGACCCGGACCTCCCGAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DCAF5 (8816)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469590
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | NM_001284208.2 | 100% | 100% | |
| 2 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | NM_003861.3 | 33% | 31.8% | (many diffs) |
| 3 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | NM_001284206.1 | 32.9% | 31.7% | (many diffs) |
| 4 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_006720297.2 | 32.4% | 30.7% | (many diffs) |
| 5 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_006720298.2 | 32.3% | 30.6% | (many diffs) |
| 6 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | NM_001284207.1 | 24.3% | 23.1% | (many diffs) |
| 7 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_017021734.1 | 24.3% | 23.1% | (many diffs) |
| 8 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_017021735.1 | 24.3% | 23.1% | (many diffs) |
| 9 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_017021736.1 | 24.2% | 23% | (many diffs) |
| 10 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_006720299.3 | 24% | 22.4% | (many diffs) |
| 11 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_011537278.1 | 24% | 22.4% | (many diffs) |
| 12 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_011537279.2 | 24% | 22.4% | (many diffs) |
| 13 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_017021733.1 | 24% | 22.4% | (many diffs) |
| 14 | human | 8816 | DCAF5 | DDB1 and CUL4 associated fa... | XM_006720300.2 | 23.9% | 22.3% | (many diffs) |
| 15 | mouse | 320808 | Dcaf5 | DDB1 and CUL4 associated fa... | NM_177267.4 | 31.2% | 30.9% | (many diffs) |
| 16 | mouse | 320808 | Dcaf5 | DDB1 and CUL4 associated fa... | XM_006516015.2 | 22.7% | 22.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1044
- ORF length:
- 978
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gaggagagct ggcctggggg gcagcatgag gtcagtggtg ggcttcttgt 121 cccagcgggg cttgcatggg gaccccctgc tcactcagga ctttcagagg agacgcctgc 181 ggggctgcag aaacctctac aagaaggacc tcctcggcca cttcggctgt gtcaatgcca 241 ttgaattctc caacaatgga ggccagtggc tggtctcagg aggagatgac cgccgggttc 301 tgctatggca catggaacaa gccatccact ccagggtcaa gcccatacag ctgaaaggag 361 agcaccattc caacattttt tgcctggctt tcaacagtgg gaacactaaa gtgttctctg 421 gaggcaatga tgagcaagtt atcctccatg atgttgaaag cagtgagaca ttggacgtgt 481 ttgctcatga agatgcagta tatggcttgt ctgtgagccc agtgaatgac aacatttttg 541 ccagttcctc agatgatggc cgggttctca tttgggacat tcgggaatcc ccccatggag 601 agcccTTCTG CCTGGCAAAC TATCCATCAG CCTTTCATAG TGTCATGTTT AACCCTGTGG 661 AGCCCAGGTT GTTGGCCACA GCCAATTCAA AGGAAGGAGT GGGACTCTGG GACATTCGAA 721 AACCTCAGAG TTCTCTCCTG CGCTATGGTG GAAACCTGTC CCTCCAAAGT GCCATGAGTG 781 TACGATTCAA CAGCAACGGG ACCCAGCTCC TGGCCCTGAG GCGACGCCTG CCCCCTGTGC 841 TCTATGACAT CCATTCCCGC CTGCCTGTGT TTCAGTTTGA CAATCAGGGT TACTTCAACT 901 CATGCACCAT GAAAAGCTGC TGTTTTGCAG GAGATCGTGA CCAGCATCAC AACTGGAAAT 961 GGAGAGCCCA AGCTGTGAGT TTCCAGCCTT TTCTGAGTCT CACCAGGAAT GGAGATGCTG 1021 ATGTTGACTT AAAGCTGGCA GTTTACCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1081 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1141 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA TCGCCAGACC 1201 CGGACCTCCC GAGACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1261 att